Prasanna

Here we are providing NCERT Solutions for Class 11 English Hornbill Poem 1 A Photograph. Students can get Class 11 English A Photograph NCERT Solutions, Questions and Answers designed by subject expert teachers.

A Photograph NCERT Solutions for Class 11 English Hornbill Poem 1

A Photograph NCERT Text Book Questions and Answers

Question 1.
What does the word ‘cardboard’ denote in the poem? Why has this word been used?
Answer:
The word “cardboard” in the poem refers to the photograph. It is just a piece of paper a memory as the poet’s mother is dead and gone. It signifies the transience of life and what remains is an insignificant piece of paper.

Question 2.
What has the camera captured?
Answer:
The camera has captured the scene when the poet’s mother and her two female cousins, Betty and Dolly, went paddling. They were holding the poet’s mother’s hands. The elder of the three was about twelve years. The three of them stood smiling as the wind tousled their hair.

Question 3.
What has not changed over the years? Does this suggest something to you?
Answer:
The sea has not changed over the years. It remains the same through generations. On the contrary, life is transient. The mother has now been dead for years. Human life is transitory and this transience is contrasted with the permanence of nature.

Question 4.
The poet’s mother laughed at the snapshot. What did this laugh indicate?
Answer:
The mother laughed at the fleeting moments that had long passed. She relived the memories when they were dressed as children and taken out. She laughed as she recalled the happy memories.

Question 5.
What is the meaning of the line “Both wry with the laboured ease of loss.”
Answer:
The poet’s mother had been out on a beach holiday, years back and felt nostalgic about it, similar to what the poet felt when she relived the memories of her dead mother. The memories, in each case, were beautiful, but painful to recall as time slipped away, so easily.

Question 6.
What does “this circumstance” refer to?
Answer:
“This circumstance” is the death of the mother. This fact is as true and as real as the one that her mother had experienced, on the beach. Both the situations are now a memory of the past. The first is a memory of the mother’s past and the second of the poet’s past.

Question 7.
The three stanzas depict three different phases. What are they?
Answer:
The first stanza is the poet’s description of the photograph that had been captured from her mother’s childhood. The second stanza deals with recollections. The mother’s recollection of her childhood just as the poet recalls her mother who is now dead. The third stanza philosophises death and the transience of life.

NCERT Solutions for Class 12 Biology Chapter 4 Reproductive Health

These Solutions are part of NCERT Solutions for Class 12 Biology. Here we have given NCERT Solutions for Class 12 Biology Chapter 4 Reproductive Health

Question 1.
What do you think is the significance of reproductive health in a society?
Solution:
Significance of reproductive health in society are:

• Control over the transmission of STDs.
• Less death due to reproduction-related diseases like-AIDS, cancer of the reproductive tract.
• Control in a population explosion.
• Not only the reproductive health of men and women affects the health of the next generation.

Question 2.
Suggest the aspects of reproductive health which need to be given special attention in the present scenario.
Solution:
Providing medical facilities and care to the problems like menstrual irregularities, pregnancy related aspects, delivery, medical termination of pregnancy, STDs, birth control, infertility. Post-natal child maternal management is another important aspect of the reproductive and child health care programme.

Question 3.
Is sex education necessary in schools? Why?
Solution:
Yes, sex education is necessary for schools because:

• It will provide proper information about reproductive organs, adolescence, safe, hygienic sexual practices, and Sexually Transmitted Diseases (STDs).
• It will provide the right information to avoid myths and misconceptions about sex-related queries.

Question 4.
Do you think that reproductive health in our country has improved in the past 50 years? If yes, mention some such areas of improvement.
Solution:
The reproductive health in our country has improved in the last 50 years. Some areas of improvement are :

• Massive child immunization.
• Increasing use of contraceptives.
• Better awareness about sex related matters.
• Increased number of medically assisted deliveries and better post-natal care leading to decreased maternal and infant mortality rates.
• Increased number of couples with small families.
• Better detection and cure of STDs and overall increased medical facilities for all sex related problems.

Question 5.
What are the suggested reasons for the population explosion?
Solution:

• Improved medical facilities
• Decline in death rate, IMR, MMR
• Slower decline in birth rate.
• Longer life span.
• Lack of 100% family planning and education among the village.

Question 6.
Is the use of contraceptives justified? Give reasons.
Solution:
Yes, the use of contraceptives is justified: To overcome the population growth rate, contraceptive methods are used. It will help in bringing birth rate down & subsequently curb population growth. With the rapid spread of HIV/ AIDS in the country, there is now a growing realization about the need to know about contraception & condoms.

Question 7.
Removal of gonads cannot be considered as a contraceptive option. Why?
Solution:
Removal of gonads not only stops the production of gametes but will also stop the secretions of various important hormones, which are important for bodily functions. This method is irreversible and thus, can not be considered as a contraceptive method.

Question 8.
Amniocentesis for sex determination is banned in our country. Is this ban necessary? Comment.
Solution:
Amniocentesis is a prenatal diagnostic technique to find out the genetic disorders and metabolic disorders of the foetus. Unfortunately, the useful technique of amnio-centesis had been misused to kill the normal female foetuses as it could help detect the sex of foetus also. Hence, this technique is now banned in our country. This ban is necessary as this technique was promoting female foeticide in our country.

Question 9.
Suggest some methods to assist infertile couples to have children.
Solution:
If the couples are enabled birth to the children and corrections are not possible, the couples could be assisted to have children through certain special techniques, commonly known as Assisted Reproductive Technologies (ART). Some methods are given as:

1. In Vitro Fertilization (IVF): In this method, ova from the female and the sperm from the male are collected and induced to form a zygote under simulated conditions in the laboratory. This process is called In Vitro Fertilization (IVF). Some method is given as follows:

• Zygote Intrafallopian Transfer (ZIFT): The zygote or early embryo with up to 8 blastomeres is transferred into the fallopian tube.
• Intra-Uterine Transfer (IUT): Embryo with more than 8 blastomeres is transferred into the uterus in females who cannot conceive embryos formed by the fusion of gametes in another female are transferred.
• Test tube baby: In this method, ova from the donor (female) and sperm from the donor (male) are collected and are induced to form a zygote under simulated conditions in the laboratory. The zygote could then be transferred into the fallopian tube and embryos transferred into the uterus, to complete its further development. The child born from this method is called a test-tube baby.

2. Gamete Intra Fallopian Transfer (GIFT): It is the transfer of an ovum collected from a donor into the fallopian tube 8 another female who cannot produce one, but can provide a suitable environment for fertilization and further development of the embryo.

3. Intra Cytoplasmic Sperm Injection (ICSI) : It is a procedure to form an embryo HI* the laboratory by directly injecting the sperm into an ovum.

4. Artificial Insemination (AI): In this method, the semen collected either from the husband or a healthy donor is artificially introduced into the vegina or into the uterus (Intra Uterine Insemination, IUI). This technique is used in cases where the male is unable to inseminate sperms in the female reproductive tract or due to very low sperm counts in the ejaculation.

5. Host Mothering: In this process, the embryo is transferred from the biological mother to a surrogate mother. The embryo then develops till it is fully developed or partially developed. It is then transferred to the biological mother or into any other. This technique is useful for females in which embryo forms but is not able to develop.

Question 10.
What are the measures one has to take to prevent contracting STDs?
Solution:
Diseases or infections which are transmitted through sexual intercourse are collectively called sexually transmitted diseases (STDs) or reproductive tract infections (RT), e.g., gonorrhea, syphilis, genital herpes, AIDS, etc. The measures that one has to take to prevent from contracting STDs are:

• Avoid sex with unknown partners/multiple partners.
• use condoms during coitus.
• In case of doubt, go to a qualified doctor for early detection and get complete treatment if diagnosed with the disease.

Question 11.
State True/False with an explanation.

1. Abortions could happen spontaneously too.
2. Infertility is defined as the inability to produce viable offspring and is always due to abnormalities/defects in the female partner.
3. Complete lactation could help as a natural method of contraception.
4. Creating awareness about sex related aspects is an effective method to improve the reproductive health of people.

Solution:

1. True: One-third of all pregnancies abort spontaneously (called miscarriage) within four weeks of conception and abortion passes unrecognized with menses.
2. False: Infertility is defined as the inability of the couple to produce viable offspring. It is due to abnormalities/defects in either male or female or both.
3. True: Complete lactation is a natural method of contraception as during this period ovulation does not occur, but this is limited to a period of 6 months after parturition.
4. True: Creating awareness in people about sex-related aspects like right information about reproductive organs, accessory organs of reproduction, safe and hygienic sexual practices, birth control methods, care of pregnant women, post-natal care of mother and child, etc., can help in improving the reproductive health of people.

Question 12.
State True/False with an explanation.
(a) Abortions could happen spontaneously too. (True/False)
Answer:
False, Abortion does not happen under normal conditions. It happens accidentally or under the will of Parents.

(b) Infertility is defined as the inability to produce a viable offspring and is always due to abnormalities/defects in the female partner. (True/False)
Answer:
False, Sterility always does not occur due to females sometimes. Males are also responsible for this.

(c) Complete lactation could help as a natural method of contraception. (True/False)
Answer:
True, the Menstrual cycle does not occur after parturition which can act as natural
contraception but this method is functional for a period of six months from parturition.

(d) Creating awareness about sex related aspects is an effective method to improve the reproductive health of dead people. (True/False)
Answer:
True, this creates better reproductive health among people.

We hope the NCERT Solutions for Class 12 Biology Chapter 4 Reproductive Health help you. If you have any query regarding NCERT Solutions for Class 12 Biology Chapter 4 Reproductive Health, drop a comment below and we will get back to you at the earliest.

Here we are providing NCERT Solutions for Class 11 English Hornbill Chapter 3 Discovering Tut: The Saga Continues. Students can get Class 11 English Discovering Tut: The Saga Continues NCERT Solutions, Questions and Answers designed by subject expert teachers.

Discovering Tut: The Saga Continues NCERT Solutions for Class 11 English Hornbill Chapter 3

Discovering Tut: The Saga Continues NCERT Text Book Questions and Answers

Discovering Tut: The Saga Continues Understanding the text

Question 1.
Give reasons for the following.

(i) King Tut’s body has been subjected to repeated scrutiny.
Answer:
1. In 1922, Howard Carter, A British archaeologist, discovered Tut’s tomb and in the process, cut the body to remove it from the coffin.

2. In 1968, a professor of anatomy x-rayed the mummy. He discovered that Tut’s breastbone and front ribs were missing.

3. In January 2005, the mummy was taken out for a CT scan.
King Tut was just a teenager when he died. He was the last heir of a powerful family that had ruled Egypt for centuries. He was laid to rest, laden with large quantities of gold, and eventually forgotten.

It was when his tomb was discovered that the modem world wondered why he had died at such an early age. The possibility of him being murdered could not be ruled out.

(ii) How are Carter’s investigation was resented.
Answer:
Howard Carter was the British archaeologist who in 1922 discovered Tut’s tomb. His investigation was resented because Carter’s men removed the mummy’s head and cut off nearly every major joint to separate Tut from his adornments. They, then, reassembled the remains on a layer of sand in a wooden box and put him back.

(iii) Carter had to chisel away the solidified resins to raise the king’s remains.
Answer:
The solidified material had to be cut away from below the limbs and chest before it was possible to raise King Tut out. This had to be done because if Carter had not cut the mummy free, thieves would have evaded the guards and tom the mummy apart to remove the gold that was buried with Tut.

(iv) Tut’s body was buried along with gilded treasures.
Answer:
Tut’s body was buried along with gilded treasures that remain the richest royal collection ever found. The beautiful works of art in gold were buried with everyday things he would want in the afterlife: board games, a bronze razor, linen undergarments, cases of food and wine. The Egyptian royals believed that they could take their riches with them after death.

(v) The boy king changed his name from Tutankhaten to Tutankhamun.
Answer:
King Tutankhaten changed his name to Tutankhamun, which meant “living image of Amun”, to show that he meant to restore the old ways. This was because Amenhotep IV, his predecessor, promoted the worship of the Aten, the sun disk, changed his name to Akhenaten, or “servant of the Aten”. He shocked the country by attacking Amun, a major god, smashing his images and closing his temples.

Question 2.
(i) List the deeds that led Ray Johnson to describe Akhenaten as “wacky”.
Answer:
According to Ray Johnson, Akhenaten was crazy because he started one of the strangest periods in the history of ancient Egypt. He promoted the worship of the Aten, the sun disk, changed his name to Akhenaten, or “servant of the Aten”, and moved the religious capital from the old city of Thebes to the new city of Akhetaten, known now as Amama. He further shocked the country by attacking Amun, a major god, smashing his images and closing his temples.

(ii) What were the results of the CT scan?
Answer:
A CT machine scanned the mummy from head to toe and created 1,700 digital X-ray images in cross section. Tut’s head was scanned in 0.62 millimetre slices to register its complicated structures to probe the secrets of his death. The neck vertebrae, other images of a hand, several views of the rib cage, and a transection of the skull showed that there was nothing amiss in his death.

(iii) List the advances in technology that have improved forensic analysis.
Answer:
Today diagnostic imaging can be done with computed tomography, or CT, by which hundreds of X-rays in cross section are put together like slices of bread to create a three-dimensional virtual body.

(iv) Explain the statement, “King Tut is one of the first mummies to be scanned—in death, as in life… ”
Answer:
King Tut is one of the first mummies to be studied under a CT scan. In real life, he was the Pharaoh—the leader of his country. Hence both in life and death he moved majestically ahead of his countrymen.

Discovering Tut: The Saga Continues Talking about the text

Discuss the following in groups of two pairs, each pair in a group taking opposite points of view.

Question 1.
Scientific intervention is necessary to unearth buried mysteries.
Answer:
Necessary

• Better tools for locating sites/information/life and death
• Better equipment to study unearthed facts for example, murder/natural death
• Evidence is evaluated scientifically
• Helps in ending doubts/fallacies through improved equipment
• Ends idle speculation through empirical proof

Unnecessary

• Engineers and scientists from Japan have not been able to find out how pyramids were built (quarrying/ transporting/placing stone) despite recreating/studying available data
• Scientific intervention destroys evidence at times
• Scientific knowledge is biased starts with a hypothesis. Investigation that begins with a predetermined outcome and searches for evidence to prove a foregone conclusion, disregards other perspectives. Research showed, for example, that the fact that Tut died of head injury was false

Question 2.
Advanced technology gives us conclusive evidence of past events.
Answer:
Gives evidence

• Recreates any event
• Better equipment and tools help in better understanding of events and situations
• Recreation and simulation of events helps in study
• Processes like carbon-dating help fix events in a timeline
• Technology like CT scans help in the study of unearthed material
• Remove fallacious beliefs

Does not give conclusive evidence

• Recreated events may not be authentic in context as information gaps may exist
• Science deals with hardcore facts; there maybe external factors in history that are as yet unknown
• Science judges and draws conclusions based on facts as they exist today; at times they may not be accurate in historical perspective
• Sometimes theories propagated may not be actual facts, for example, the theory that Tut was murdered
• Not an accurate determinant for human behaviour and other sociological facts

Question 3.
Traditions, rituals and funerary practices must be respected.
Answer:
Should be respected

• They are based on beliefs people held dear and they should be respected
• Disrespect to Amun the god most popular in ancient Egypt probably led to the downfall of Amonhotep IV
• People do not like these beliefs questioned
• These beliefs often prove to be scientifically beneficial
• We do not have the right to disrespect views of others

Question 4.
Knowledge about the past is useful to complete our knowledge of the world we live in.
Answer:
Useful

• Helps one to draw conclusions from the past events
• Makes one’s life richer by giving meaning to the books one reads, the cities one visits or the music one hears
• Broadens one’s outlook by presenting to one an admixture of races, a mingling of cultures and a spectacular drama of the making of the modem world out of diverse forces
• Enables one to grasp one’s relationship with one’s past
• Preserves the traditional and cultural values of a nation, and serves as a beacon of light, guiding society in confronting various crises
• A bridge connecting the past with the present and pointing the road to the future

Not useful

• History is layered, tribes came and went, kings, priests, religions and ideologies came and went, what spot of geography remained eternal, unnecessarily causes a divide
• Politicians appeal (selectively) to history, to rouse the rabble, inflaming people to violence, and naturally, the other
• Side will retaliate, justifying their equally murderous actions with their version of history

Discovering Tut: The Saga Continues Thinking about language

Question 1.
Read the following piece of information from The Encyclopedia of Language by David Crystal.
Answer:
Egyptian is now extinct: its history dates from before the third millennium B.C., preserved in many hieroglyphic inscriptions and papyrus manuscripts. Around the second century A.D., it developed into a language known as Coptic. Coptic may still have been used as late as the early nineteenth century and is still used as a religious language by Monophysite Christians in Egypt.

Question 2.
What do you think are the reasons for the extinction of languages?
Answer:

• With increasing disuse, not because the peoples themselves, with their cultural traditions, have dwindled away, but because the language has been overwhelmed by a more dominant one.
• A language needs a nation (in the broad sense of people conscious of a group identity) that sees it as ‘its own’failing this the language dies out
• A language’s social status determines its life or death. If its speakers turn away more and more from using a language that is perceived as conferring real benefits in everyday life, it dies out
• The introduction of a non-indigenous language that takes over all social functions
• The disappearance of a population that speaks that language
• Parents do not pass on a language to their children
• Population dislocation or relocation due to events like war, famine, earthquakes
• The emergence of a new world language
• The emergence of supra linguistic functions like banking information in another language

Question 3.
Do you think it is important to preserve languages?
Answer:
Language diversity is essential to the human heritage. Each and every language embodies the unique cultural wisdom of a group of people. The loss of any language is thus a loss for all humanity. It is essential to preserve languages in order to preserve fundamental human rights, and for the protection of minority groups. Language is an important marker of identity. Even when speaking the same language, social groups differentiate themselves by their dialect or the way they talk.

So, language offers a way of stating a resistance to cultural homogenisation. A native language goes beyond differentiation. It represents a whole cultural history. The need to define one’s roots, especially in the face of what can look like foreign hegemony, is powerful. ‘Linguistic diversity’ is a benchmark of cultural diversity. The death of a language is symptomatic of cultural death: a way of life disappears with the death of a language. Language is a cultural resource, and must be transmitted to children.

Question 4.
In what ways do you think we could help prevent the extinction of languages and dialects?
Answer:
Although approximately 6,000 languages still exist, many are under threat. There is an imperative need for language documentation, new methods, new policy initiatives and safeguarding strategies to enhance the vitality of these languages. The cooperative efforts of language communities, language professionals, NGOs and governments will be indispensable in countering this threat.

There is a pressing need to build support for language communities in their efforts to establish meaningful new roles for their endangered languages. One important issue in preserving a language is how widely it is used in written form. Prerequisites for the written use of a language are orthography development, literature production, and the teaching of mother-tongue literacy.

Discovering Tut: The Saga Continues Working with words

Question 1.
Given below are some interesting combinations of words. Explain why they have been used together.
Answer:

• ghostly dust devils – a dust devil is a whirlwind into which dust and debris gets caught up, making it visible and making it look like a ghost
• desert sky – blank/lifeless sky
• stunning artefacts – breathtakingly beautiful objects made by humans
• funerary treasures – jewels or precious objects relating to or suitable for a burial or funeral
• scientific detachment – methodical aloofness
• dark-bellied clouds – dark, bulging clouds
• casket grey – ash-coloured like a coffin
• eternal brilliance – endless lustre/radiance
• ritual resins – resins used in a system of rites
• virtual body – figure of the body generated by the computer
• The above descriptions are very vivid and make understanding/visualisation better.

Question 2.
Here are some commonly used medical terms. Find out their meanings.
(a) CT scan – A CT (computerised tomography) scanner is a medical imaging method employing tomography where digital geometry processing is used to generate a three-dimensional image of the internals of an object from a large series of two-dimensional X-ray images taken around a single axis of rotation.

(b) MRI – Magnetic Resonance Imaging (MRI) is a diagnostic medical imaging technique utilising the principles of nuclear magnetic resonance. MRI is viewed by many as the most versatile, powerful and sensitive diagnostic imaging modality available. Its medical importance can be summarised briefly as having the ability to non- invasively generate thin sections, functional images of any part of the body at any angle and direction in a relatively short period of time.

(c) tomography – production of body image; the technique of using ultrasound, gamma rays, or X-rays to produce a focussed image of the structures across a specific depth within the body, while blurring details at other depths

(d) autopsy – examination to find cause of death: the medical examination of a dead body in order to establish the cause and circumstances of death

(e) dialysis – medical filtering process: the process of filtering the accumulated waste products of metabolism from the blood of a patient whose kidneys are not functioning properly, using a kidney machine

(f) ECG – an electrocardiogram is a graphic produced by an electrocardiograph, which records the changes in the electrical current in the heart during heartbeats in the form of a continuous strip graph. The results of the ECG are used to tell whether the heart is performing normally or suffering from abnormalities.

(g) post mortem – examination made after death to determine the cause of death

(h) angiography – Angiography is the X-ray (radiographic) study of the blood vessels. Angiography is used to detect abnormalities, including narrowing or blockages in the blood vessels throughout the circulatory system and in some organs.

The procedure is commonly used to diagnose heart disease; to evaluate kidney function and detect kidney cysts or tumours; to map renal anatomy in transplant donors; to detect an abnormal bulge of an artery that can rupture leading to haemorrhage, tumour, blood clot, or abnormal tangles of arteries and veins in the brain; and to diagnose problems with the retina of the eye.

i) biopsy – removal of living tissue: the removal of a sample of tissue from a living person for laboratory examination

Discovering Tut: The Saga Continues Things to do

Question 1.
The constellation Orion is associated with the legend of Osiris, the god of the afterlife. Find out the astronomical
descriptions and legends associated with the following.
Answer:
(i) Ursa Major (Saptarishi mandala) – This is also known as the Great Bear, because of its shape, recognised early on by Romans and Native Americans. In Hindu mythology each of the stars represents one of the Saptarshis or seven sages.

(ii) Polaris (Dhruva tara) – Also known as the North star or pole star, the brightest star in the Ursa Minor constellation. In ancient Hindu literature Polaris was given the name Dhruva or immovable, fixed in one place.

(iii) Pegasus (Winged horse) – A bright constellation in the northern sky. Pegasus was depicted as a white winged stallion, one of the children of the Greek god Poseidon.

(iv) Sirius (Dog star) – From the ancient greek term for glowing, one of the brightest stars in the Earth’s night sky.
This is presented as Orion’s dog, who hunts for the Greek god Zeus.

(v) Gemini (Mithuna) – One of the zodiac constellations. The Latin word Gemini translates to twins, representing the pair Castor and Pollux, sons of the Spartan Queen Leda. Similarly, Mithuna in Indian astrology stands for couple or union.

Question 2.
Some of the leaves and flowers mentioned in the passage for adorning the dead are willow, olive, celery, lotus, cornflower. Which of these are common in our country?
Answer:
The Indian willow, lotus, and cornflower are found in several places across the country.

Question 3.
Name some leaves and flowers that are used as adornments in our country.
Answer:
Leaves used for adornment in India include mango leaves, banana leaves, tulsi leaves, banyan leaves, peepal tree leaves and so on. Flowers used for adornment include marigolds, roses, lotus flowers, jasmine flowers, hibiscus flowers and so on.

Here we are providing NCERT Solutions for Class 11 English Hornbill Chapter 4 Landscape of the Soul. Students can get Class 11 English Landscape of the Soul NCERT Solutions, Questions and Answers designed by subject expert teachers.

Landscape of the Soul NCERT Solutions for Class 11 English Hornbill Chapter 4

Landscape of the Soul NCERT Text Book Questions and Answers

Landscape of the Soul Understanding the text

Question 1.
(i) Contrast the Chinese view of art with the European view with examples.
Answer:
In the Chinese view, art is a representation of the mind or the spirit, whereas in the European view, it is of the figure or the body. While Chinese paintings reveal the inner world, the European paintings lay emphasis on a true representation of the physical appearance of the subject.

The examples of paintings by Wu Daozi and Quinten Metsys are representative of this difference. The painting by Metsys is life-like. It is an exact representation of a fly. The painting of Daozi, on the other hand, is not only beautiful but alive too. It has a way within that only the painter is aware of.

(ii) Explain the concept of shanshul
Answer:
Shanshui expresses the Chinese view of art as a conceptual space. It literally means mountain-water, which, when used together, represent the word ‘landscape’. Mountain and water represent two complementary poles of an image. They are essentially Yang and Yin, two seemingly opposing forces complementing each other for a unified whole, the landscape. The mountain is Yang – stable, warm and dry in the sun, reaching vertically towards the sky, while the water is Yin – fluid, moist and cool, horizontal and resting on the earth.

Question 2.
(i) What do you understand by the terms ‘outsider art’ and ‘art brut’ or ‘raw art’?
Answer:
Outsider art is a term that describes artistic creations by someone who has no formal training to be an artist. However, they show unmistakable artistic talent and insight, and their work poses a stimulating contrast to the mainstream art. Art brut or raw art, a term used by the painter Jean Dubuffet, refers to art forms which are outside the conventions of the mainstream art world. They are in their raw state in respect of their cultural and artistic influences.

(ii) Who was the “untutored genius who created a paradise ” and what is the nature of his contribution to art?
Answer:
The untutored genius was Nek Chand Saini. He created a rock garden in Chandigarh. The garden is entirely sculpted with stones and recycled materials.

Landscape of the Soul Talking about the text 

Discuss the following statements in groups of four.

Question 1.
“The Emperor may rule over the territory he has conquered, but only the artist knows the way within.”
Answer:
The Tang Emperor Xuanzong may have commissioned Wu Daozi to create a great work of art. The Emperor wields power over his territory and wealth to control the lives of his people. However, the artist who creates a work of art understands his work in a manner that nobody can. In Wu Daozi’s case, we see that the Emperor cannot enter the work of art as Wu does, because despite all his power, he can never be a part of the space shared by Wu and his work of art. That relationship is too sacred and personal a space for anybody to enter.

Question 2.
“The landscape is an inner one, a spiritual and conceptual space.”
Answer:
This landscape is described by the article as Shanshui, which translates to mountain-water. Two different sides to an artwork, just like Yin and Yang. The mountain which reaches towards heaven and the water which treads across the earth. These two sides therefore also portray the spiritual which transcends into the heavenly, and the conceptual which wades through the earth. In this landscape the artist has been able to capture a scene not just as he would view it, but more than that, subjectively the multiple ways in which his mind would think about a landscape. He wants the viewer to be able to enter and understand his mind.

Landscape of the Soul Thinking about language

Question 1.
Find out the correlates of Yin and Yang in other cultures.
Answer:
In Christianity, this can be seen in the struggle between being heaven for those who repent of sin and hell for those who do not. In Vedanta philosophy in the Gita this can be seen in the division between Akshara, the invisible soul and the Kshara, the visible body. Similarly many other cultures have similar binaries between black and white, good and evil and so on.

Question 2.
What is the language spoken in Flanders?
Answer:
Although Flanders is in Belgium, the language primarily spoken in the region is Dutch.

Landscape of the Soul Working with words

I. The following common words are used in more than one sense.
panel , studio , brush , essence , material

Examine the following sets of sentences to find out what the words, ‘panel’ and ‘essence’ mean in different contexts.

Question 1.
(i) The masks from Bawa village in Mali look like long panels of decorated wood.
Answer:
A flat rectangular piece of wood

(ii) Judge H. Hobart Grooms told the jury panel he had heard the reports.
Answer:
A small group of people selected to pass a judgement

(iii) The panel is laying the groundwork for an international treaty.
Answer:
A small group of people selected to represent a larger group

(iv) The glass panels of the window were broken.
Answer:
A flat rectangular piece of glass, which is part of a window

(v) Through the many round tables, workshops and panel discussions, a consensus was reached.
Answer:
A small group of people that participates in a discussion amongst themselves

(vi) The sink in the hinged panel above the bunk drains into the head.
Answer:
A rectangular case used to keep something

Question 2.
(i) Their repetitive structure must have taught the people around the great composer the essence of music.
Answer:
What goes into composing music

(ii) Part of the answer is in the proposition; but the essence is in the meaning.
Answer:
The actual answer

(iii) The implications of these schools of thought are of practical essence for the teacher.
Answer:
Practically the most important aspect

(iv) They had added vanilla essence to the pudding.
Answer:
A strong liquid used to add flavour

II. Now find five sentences each for the rest of the words to show the different senses in which each of them is used.

Studio

• I live in a studio apartment.
• They hired a studio to record their music album.
• That is one of the most famous studios because the biggest actors work for them.
• Can we get a studio audience for the news channel’s evening show?
• He owns a ballet studio on the other side of the city.

Material

• This factory produces a lot of waste material.
• Thankfully the storm did not cause any material damage in the town.
• The material foundations of the building have been laid.
• Do you have the material needed to make the dress?
• He is very fond of material things, and therefore can never be trusted.

Brush

• He needs to brush up on his knowledge of the subject.
• I used to brush my shoes but then I could no longer find the time.
• She needs a new brush to paint with.
• He would brush past me every day on the metro because he was in such a hurry.

Noticing form

• A classical Chinese landscape is not meant to reproduce an actual view, as would a Western figurative painting.
• Whereas the European painter wants you to borrow his eyes and look at a particular landscape exactly as he saw it, from a specific angle, the Chinese painter does not choose a single viewpoint.
  The above two examples are ways in which contrast may be expressed. Combine the following sets of ideas to show the contrast between them.

Question 1.
(i) European art tries to achieve a perfect, illusionistic likeness
(ii) Asian art tries to capture the essence of inner life and spirit.
Answer:
European art tries to perfect the image of the world it captures, trying to be as close to real life as possible, whereas Asian art tries to go beyond the physical world to capture the subjective picture, as one’s inner life and spirit would see it.

Question 2.
(i) The Emperor commissions a painting and appreciates its outer appearance,
(ii) The artist reveals to him the true meaning of his work.
Answer:
While the Emperor pays for the artwork and appreciates the physical depiction that is portrayed, only the artist who carefully crafts the painting understands the true meaning of his work.

Question 3.
(i) The Emperor may rule over the territory he has conquered
(ii) The artist knows the way within.
Answer:
While the Emperor wields power to rule over his kingdom, only the artist understands the method he uses in his artwork, and how the work reflects the mysterious nature of the universe.

Landscape of the Soul Things to do

Question 1.
Find out about as many Indian schools of painting as you can. Write a short note on the distinctive features of each school.
Answer:
Mughal Painting: This began during the reign of Humayun, the 2nd Mughal emperor. This style of painting was influenced heavily by Persian art. Mughal painters used bright colours, focussed on the fine details of costumes and gold, and also captured scenes of wildlife and nature. Most portraits of famous courtiers and royalty had the subjects posing with particular gestures of hands and face. Considered the golden period for miniature painting in India.

Rajasthani Painting: This style of painting began under the Rajput emperors after the 17th century. This began after the relationship between the Mughal and the Rajasthani empires improved, leading to influence of Mughal painting on local artists. Most of the painters chose their subjects as scenes taken from Hindu religious poetry. Traditional painting on walls was replaced by miniature paintings.

Pahari Painting: Most of these painters practiced their art in places like Kashmir, Punjab, Uttar Pradesh and neighbouring territories. Here also a lot of bright colours were used, with themes that varied from focussing on nature to depicting the gracefulness of female subjects .

Bengal School of Art: A more recent school which began during the British Raj in the early 20 century. It was a part of the Indian nationalist movement, which sought to distinguish itself from art forms promoted in British art schools across India. Therefore the themes focussed on by painters were also those that may help promote Indian nationalism. Some other schools of art in Indian include Tribal painting, Kerala mural painting and so on.

Question 2.
Find out about experiments in recycling that help in environmental conservation.
Answer:
Some recent efforts to cut down on environmental pollution include the setting up of recycling centers to collect material that can be used again like tin cans, plastic bottles and containers, electronic equipment and waste paper. The setting up of trash bins to separate degradable and non-degradable waste has also helped reduce the amount of waste in garbage dumps. Further inventions like biodegradable bags and bottles, cars running on electricity or water instead of petrol, robots to sift through trash cans to utilise waste, and so on have helped the process of environmental conservation.

Here we are providing NCERT Solutions for Class 12 English Flamingo Chapter 2 Lost Spring. Students can get Class 12 English Lost Spring NCERT Solutions, Questions and Answers designed by subject expert teachers.

Lost Spring NCERT Solutions for Class 12 English Flamingo Chapter 2

Lost Spring NCERT Text Book Questions and Answers

Lost Spring Think as you read 

Question 1.
What is Saheb looking for in the garbage dumps? Where is he and where has he come from?
Answer:
Unlike his parents who sifted through the garbage dumps for their survival, Saheb took it to be a treasure trove, wondrous and magical. He sometimes chanced upon a coin and hoped of finding more. He lived in Seemapuri. His family had arrived from Bangladesh in 1971.

Question 2.
What explanations does the author offer for the children not wearing footwear?
Answer:
The author disagreed with the usual explanation that is offered for the children going barefoot as a part of tradition in India. She felt it was only an excuse for the lack of money. They could ill-afford shoes as they lived in “a perpetual state of poverty”.

Question 3.
Is Saheb happy working at the tea-stall? Explain.
Answer:
Saheb was secure working at a tea-stall where he received daily wages and was given regular meals. However, it can be guessed that he was unhappy as he does not answer the writer when asked if he was happy. The writer also noticed that his face no longer carried the carefree look. He looked burdened with responsibilities.

Question 4.
What makes the city of Firozabad famous?
Answer:
Firozabad was famous for its bangles. Most families in Firozabad were engaged in making bangles. It engaged most of the families in its central industry. They worked around furnaces, welding glass and making bangles.

Question 5.
Mention the hazards of working in the glass bangles industry?
Answer:
Bangles were manufactured in glass furnaces with high temperatures, in dingy cells without air or light. As a consequence, the children, who slogged away in cloistered rooms close to the hot furnaces, often lost the brightness of their eyes, even their vision.

Question 6.
How is Mukesh’s attitude to his situation different from that of his family?
Answer:
Mukesh’s father worked as a tailor and as a bangle maker. He passed on his bangle-making skill to his family.
However, Mukesh dreamt of becoming a car mechanic, and wanted to break away from the occupation his family had been involved in for generations.

Lost Spring Understanding the text

Question 1.
What could be some of the reasons for the migration of people from villages to cities?
Answer:
Although it is difficult for the people to relocate from villages to cities, migration of such a nature continues unabated. People migrate for various reasons. These could be:

• de-fragmentation of land holdings
• lack of job opportunities
• lack of physical infrastructure no factories or other forms of employment, no medical support, no educational institutions, etc.
• lack of public health amenities such as sewage, drainage, etc.
• inability to deal with environmental hazards such as rains, storms, etc.
• glamour of the city life lures youngsters
• limited opportunities for progress
• aspirations for a better lifestyle

Question 2.
Would you agree that promises made to the poor children are rarely kept? Why do you think this happens in the incidents narrated in the text?
Answer:
Promises made to the poor children are rarely kept. Promises are made both at the national and international levels to provide healthy lives, quality education, protection against abuse, exploitation and violence, and combating HIV or AIDS. Yet, it is estimated that 246 million children are engaged in child labour. Of those, almost 171 million work in hazardous conditions, such as in mines, with chemicals and pesticides in agriculture or with dangerous machinery.

In some sectors their presence is kept under wraps where they toil away as domestic servants in homes, and labouring behind the walls of workshops. Millions of girls work as domestic servants and as unpaid household help and are especially vulnerable to exploitation and abuse. As the world looks ahead to prosperity, many children barely have a future, trapped in the conditions of poverty, conflict, and a degraded environment.

Just like Saheb and Savita, their future continues to be bleak. The children become disillusioned and often turn cynical. This happens because of utter poverty and the failure of the government to provide social security to the people.

Question 3.
What forces conspire to keep the workers in the bangle industry of Firozabad in poverty?
Answer:
Despite a government ban on child labour, 20,000 children in Firozabad work in horrific conditions to support their poor families. The workers are exposed to hazards such as blindness, tuberculosis, bronchitis, etc. In spite of working in such hazardous conditions the children are underpaid.They are forced to lead this life of poverty, as bangle-making continues to be their only means of livelihood. They can barely afford two square meals a day. They lack money and enterprise to do anything except carry on the business of

making bangles. The young men follow in the path of their elders as the profession is carried from one generation to the next. Years of mind-numbing toil kills their drive and their ability to dream. They lack the education and awareness to organise themselves into a cooperative and escape the vicious circle created by middlemen. The fear of the police and lack of leadership keep them back They remain caught in a web of poverty, burdened by the stigma of caste. The bureaucrats and the politicians exploit them further.

Lost Spring Talking about the text

Question 1.
How, in your opinion, can Mukesh realise his dream?
Answer:
Mukesh, one of the many children in Firozabad, aspired to be a motor mechanic. His dreams were unlike those of his peers, who worked in bangle manufacturing units amidst appalling conditions. Most of the people there, caught in the vicious circle, were bom and died in the same miserable plight as their forefathers. Mukesh, however, dared to dream.

He was determined to go to a garage and learn how to become a garage mechanic. He realized that the garage was a long way from his home, yet he was resolute and decided to walk all his way there. He dreamt of driving cars that he saw hurtling down the streets of his town. His passion and perseverance would help him achieve his goal. Mukesh was able to dream of breaking away from tradition, and that was the first step towards the realisation of his dreams.

Question 2.
Mention the hazards of working in the glass bangle industry.
Answer:
Child labour gives rise to a situation where the children are forced to work in dangerous and unhealthy conditions that scar them physically, emotionally, and mentally for the rest of their lives. The glass and glassware industry in India is concentrated in Firozabad. These factories produce a number of glass items, such as bangles, chandeliers, wine glasses, beads, crockery, bulbs, and cut glass items. The industry employs about 8,000 to 50,000 children, some as young as eight years old. The factory floor is like an inferno, due to the intense heat, poor ventilation, broken glass, dangling electric wires, and lack of protective equipment.

Often, glass splinters injure the workers, and pieces of glass cut into the bare feet of children. The children bump into each other and may scorch their bodies. Children are seen walking barefoot over glass littered floors, some with scarred eyes and burnt scalps. Child workers in the glass factories in Firozabad suffer from mental regression, asthma, bronchitis, eye problems, liver ailments, skin bums, chronic anaemia, and tuberculosis. Studies conducted at the Maulana Azad Medical College, in New Delhi, show genetic damage in the body cells of the labourers who have worked close to furnace heat for three years or more.Children, working in factories, often suffer from emotional, mental, and psychological scars.

Question 3.
Why should child labour be eliminated and how?
Answer:
There are various harmful effects of child labour. These include:
(a) Economic exploitation: Children may only receive one quarter of adult wages.
(b) Long working hours: Some children are expected to work for excessive hours, often up to 12-16 hours per day.
(c) Loss of educational opportunities: Children, who work, either give up their school education or find that their educational performance declines because of their work.
(d) Physical harm: Working children experience physical harm in a number of ways in terms of:require concerted efforts from all sections of the society to make a dent in the problem. It can be eliminated by:

• Increased risk of accidents
• Risk of physical violence from people in authority
• Theft is a risk faced by children who work as street vendors
• Risk of illness from poor hygiene and exposure to bad weather
• Harmful effects of chemicals

(e) Abuse and exploitation: It is essentially a socio-economic problem inextricably linked to poverty and illiteracy.
It will

• Legislative action plan
• Focusing general developmental programmes for benefitting child labour
• Subsidising education
• Providing basic necessities

Lost Spring Thinking about language

Question.
Carefully read the following phrases and sentences taken from the text and name the figures of speech used.
Answer:

• Saheb-e-Alam which means the lord of the universe is directly in contrast to what Saheb was in reality. The figure of speech used – irony
• “Drowned in an air of desolation”. The figure of speech used – hyperbole
• “Seemapuri, a place on the periphery of Delhi yet miles away from it, metaphorically.” The figure of speech
  used –  metaphor/irony
• “For the children it is wrapped in wonder; for the elders it is a means of survival.” The figure of speech
  used – contrast
• “As her hands move mechanically like the tongs of a machine, I wonder if she knows the sanctity of the bangles she helps make.” The figure of speech used – simile
• “She still has bangles on her wrist, but no light in her eyes.” The figure of speech used – paradox/contrast
• “Few airplanes fly over Firozabad.” The figure of speech used – metaphor/sarcasm/contrast
• “Web of poverty”, the figure of speech used – metaphor
• “Scrounging for gold”, the figure of speech used – metonymy/hyperbole
• “And survival in Seemapuri means rag-picking. Through the years, it has acquired the proportions of a fine art.” The figure of speech used – hyperbole/sarcasm
• “The steel canister seems heavier than the plastic bag he would carry so lightly over his shoulders.” The figure of speech used – metaphor

Lost Spring Extra Questions and Answers

Lost Spring Short Answer Questions

Question 1.
Who was Saheb? Where was he and where had he come from? What did he look for in the garbage dumps?
Answer:
Saheb was a child who had been forced by circumstances to become a ragpicker. His family had migrated from the green fields of Dhaka, Bangladesh in 1971. They had been forced to move out because storms had swept away all they had. They had shifted to Delhi to make a living. They lived in the slums of Seemapuri. Each day the child went looking for money in garbage heaps.

Question 2.
Saheb was a victim of circumstances. Justify.
Answer:
Saheb had once lived in the green fields of Dhaka but the storms swept away their fields and homes. Consequently, he ended up in Delhi as a ragpicker. There was an inherent desire in him to attend school and study. This could not be fulfilled because of poverty. When Anees suggested that he go to school, he was excited and a few days later asked her if her school was ready.

Question 3.
Bring out the irony in Saheb’s name.
Answer:
Saheb’s name was “Saheb-e-Alam” Ironically, it meant, lord of the universe. But that was something he would never know. Even if he did, he would have found it hard to believe. He roamed the streets barefoot scrounging the garbage heaps, but hardly managed to get one full meal.

Question 4.
Explain: “Seemapuri, a place on the periphery of Delhi, yet miles away from it, metaphorically”.
Answer:
Geographically, Seemapuri is a place on the outskirts of Delhi. It housed migrants from Bangladesh, who earned their living as ragpickers. A run-down place that lacked amenities of sewage, drainage, or running water, it was unlike the life of glitter and glamour in Delhi. People in Delhi lived a luxurious life in contrast to the poverty prevailing in Seemapuri.

Question 5.
What does garbage mean to adults and the children in the slum?
Answer:
Garbage meant different things to the adults and to the children in the slum. To the adults in Seemapuri, rag¬picking meant survival. It had assumed proportions of fine art. On the other hand, to the children garbage was like a mysterious package. They scrounged through it to discover unknown valuables.

Question 6.
Saheb is resigned to his fate and does not covet for what he considers is beyond his means. Justify.
Answer:
Saheb, a poor ragpicker, had resigned himself to his fate. He knew the areas that were out of bounds for him. He used to stand by the fenced gate of the club and was content watching others play tennis. He ventured into the club, to swing when no one was around. He had accepted his place in the society where he had to subsist on the items discarded by the privileged—tennis shoes, shirt and shorts. He gladly accepted work at a tea stall although it robbed him of his freedom.

Question 7.
How was Mukesh different from Saheb?
Answer:
Saheb was more resigned to his fate and had given up the freedom he enjoyed as a ragpicker for a salaried job at a tea stall. On the other hand, Mukesh insisted on being his own master. He was determined to be a motor mechanic. He was not prepared to compromise his dreams and give in like Saheb. He had even chalked out a path to achieve his dreams.

Question 8.
What did most slum dwellers do for a living in Firozabad?
Answer:
Firozabad is known for its bangles; it is the centre of India’s glass-blowing industry. Many people are employed in this industry. Families have spent generations working around furnaces, welding glass and making bangles. Since child labour is cheap, this place has around twenty thousand children who work in the hot furnaces. These children often lose vision before they become adults because of the environment they work in.

Question 9.
Describe the scene in Mukesh’s house as viewed by the narrator.
Answer:
Mukesh was another young child who had been forced by poverty into child labour. He lived in a dilapidated shanty with garbage strewn around. His house was a half-built shack, thatched with dead grass and a wobbly iron door. When the narrator visited the place, she noticed a firewood stove with a large vessel of spinach leaves. She also noticed a frail very young woman cooking. Later she realized she was wife of Mukesh’s elder brother. The narrator also saw Mukesh’s grandmother and his father, who were weak having spent their . lives making bangles.

Question 10.
How do you know that everyone in Mukesh’s family had resigned to their fate?
Answer:
Like most people in Firozabad, Mukesh was bom in the caste of bangle makers. Mukesh’s father was a poor bangle maker who had worked hard, first as a tailor. But despite slogging all his life, he had not been able to renovate a house or educate his two sons. Hence he had no option but to pass on the art of making bangles to his sons. Mukesh’s grandmother was an old woman who had watched her husband go blind but she did not complain. She accepted it as her fate of her “god-given lineage”. It was only Mukesh who dreamt of breaking out and being a mechanic.

Question 11.
The future of the slum dwellers in Firozabad is as bleak as their present. Why does the writer feel so?
Answer:
The future of the slum dwellers in Firozabad was as bleak as their present. The families were trapped in poverty, a curse that continued for generations. They also faced the stigma of having been bom in a lower caste and were victimized by the inhuman sahukars, the middlemen, the policemen, the keepers of law, the bureaucrats and the politicians. With all forces working against them, they were unable to defy the norms.

Question 12.
Why didn’t the people in Firozabad organize themselves into a cooperative to fight the system?
Answer:
Despite being exploited, the people in Firozabad were unable to organize themselves into a cooperative to escape from being manipulated and fight the system. Had they organized themselves into cooperatives, they ran the risk of running into trouble with the authorities. Moreover, there was no leader among them who could lead them. They were trapped in the vicious cycle of poverty, indifference, greed and injustice.

Question 13.
Mukesh dreams of a different future. What does he dream of? How does he want to accomplish his dreams?
Answer:
Mukesh was bom in a family of poor slum dwellers. He has been taught to work in the glass factory but Mukesh did not want to follow the traditional profession. He dreamt of being a motor mechanic. He wanted to learn about cars and was determined to leam the skill in order to ensure for himself a better life.

Question 14.
Explain: Few airplanes fly over Firozabad.
Answer:
Mukesh wanted to be a motor mechanic and he was prepared to walk to the garage to leam. He never dreamt of flying a plane as to the slum dwellers in Firozabad, planes were a far-fetched reality. Because of the limited exposure in the slums of Firozabad, Mukesh dreamt within his means.

Lost Spring Long Answer Questions

Question 1.
Describe the miserable plight of the people in Seemapuri.
Answer:
Seemapuri was a locality on the outskirts of Delhi which housed unlawful residents who came from Bangladesh back in 1971. This area was a place where thousands of ragpickers lived. The people lived in structures of mud, with roofs of tin and tarpaulin. There was no sewage system, no drainage or running water. The migrant poor lived there for more than thirty years without an identity, without permits but with ration . cards that got their names on voters’ lists. The children in these slums grew up to become partners in survival as ragpickers. To them, garbage heaps were like gold mine that would ensure their daily bread and a roof over their heads.

Question 2.
“But promises like mine abound in every comer of his bleak world.” What does the writer mean?
Answer:
The narrator, Anees, met Saheb every morning looking for money in the garbage. Saheb confessed to the narrator that he scrounged the rubbish heaps as he had nothing better to do. He longed to go to school but there was not one in the neighbourhood. When Anees asked him half joking that if she started a school, would he join, he consented very gladly. In fact he was so enamoured with the idea that a few days later he asked her if her school was ready. Anees was embarrassed at having made a promise that she was not serious about. She felt that most people made promises to children like him that were never fulfilled.

Question 3.
What do people have to say about people walking barefoot? What is the writer’s opinion?
Answer:
The writer narrates an experience when she asked a child why they were barefoot. One replied that his mother did not bring them down from the shelf, while the other boy felt that he would throw them off anyway. Yet another boy expressed his desire for shoes. The writer recalled having seen children walking barefoot. She had been informed that people walked barefoot not because of lack of money but due to the tradition in India. She wondered if this was an excuse to explain away the perpetual poverty. She had also heard of a boy from Udipi, who prayed every morning for a pair of shoes.

Question 4.
Explain: The steel canister seems heavier than the plastic bag.
Answer:
The writer, one morning, saw Saheb on his way to the milk booth carrying a steel canister. He had relinquished his job as a ragpicker and had taken up employment in a tea stall for eight hundred rupees.His face had lost the carefree look when he roamed the streets like a vagabond. As a ragpicker he seemed carefree, constantly looking for things—“wrapped in wonder”.

At the tea stall he was now burdened with the responsibility of a job. He was literally and metaphorically fraught with the weight of the steel canister. The canister was heavier than the plastic bag that he carried “lightly over his shoulder”. The plastic bag was light because the bag gave him the freedom to lead a life that was not governed by adults. He was no longer the master of his own free will after he was burdened by the job at the tea stall.

Question 5.
Describe the poverty of living conditions of the people in Firozabad.
Answer:
Firozabad is a city known for bangles and glass industry. However the people working in the industry led a pitiable life. They lived in dilapidated, dingy houses in cloistered lanes that were foul smelling and clogged with garbage. Their homes were hovels with crumbling walls, shaky doors, no windows, and crowded with families of humans and animals living together.

Mukesh’s house was no better. It was a half-built shack. One part of the house was thatched with dead grass and it had a wobbly iron door. Most of the houses were similar dark huts. The children worked under flickering .oil lamps with their parents, welding pieces of coloured glass into circles of bangles. Their eyes were more adjusted to the dark than to the light outside. Hence, they often ended up losing their eyesight before they became adults. The people were exploited by sahukars, the middlemen, the policemen, the keepers of law, the bureaucrats and the politicians.

Question 6.
Describe the writer’s visit to Mukesh’s place.
Answer:
Anees visited Mukesh’s house in Firozabad, a place known for its glass industry. Mukesh was bom in the caste of bangle makers. Anees noticed a weak young woman, the wife of Mukesh’s elder brother, cooking . the evening meal for the whole family. She was very young but as the daughter-in-law of the house, was in charge of three men—her husband, Mukesh and their father.

Mukesh’s father was an impoverished bangle maker. He had worked hard, first as a tailor, then a bangle maker. Despite years of relentless labour, he had neither been able to renovate a house, nor send his two sons to school.Mukesh’s grandmother had watched her husband go blind with the dust from polishing the glass of bangles. But she had accepted it as her fate. She felt that “god-given lineage” could never be broken.

Question 7.
Mukesh is not like the others. His “dream(s) loom like a mirage amidst the dust of streets that fill his town Firozabad.” Justify.
Answer:
Mukesh was born in a family riddled with poverty. He and his family were leading a difficult life that was not uncommon to the people of that socio-economic strata. But that had not deterred his desire to lead a different life. Mukesh was determined to be his own master. He had decided to become a motor mechanic and was . determined to leam to drive a car.

When Anees heard of that, she felt that Mukesh’s dreams were like a mirage—unattainable because it was difficult for him to break out of the generations of bangle-making tradition. She was convinced it would be difficult for Mukesh to achieve his unconventional dream.

Question 8.
In your opinion, can Mukesh realize his dream?
Answer:
Yes, Mukesh could certainly achieve his dream as he dared to dream in the first place. He was unlike most people who spent their lives doing what their families had done for generations. Mukesh had a tangible plan in action to realize his dreams. He was determined to go to a garage and leam more about cars. Despite the fact that the garage was at a distance, he was resolute. “I will walk,” he said. His passion and perseverance would certainly help him achieve his goals.
OR
No, Mukesh will not be able to realize his dream because there were thousands of families trapped in poverty ‘ who face the stigma of caste system. To cap it all, they live with insensitive people who exploit the situation. The inhuman sahukars, the middlemen, policemen, the keepers of law, the bureaucrats and the politicians— all work against them. These poor people are unable to come out of their misery because they lack education or leadership. Mukesh’s dream will too die a death like many others of his station.

Lost Spring Value Based Question

Question 1.
What societal evils are depicted in the “Stories of Stolen Childhood”?
Answer:
Anees Jung voices her concern over the exploitation of children in hazardous jobs such as bangle making and rag-picking. Grinding poverty and thoughtless traditions result in the loss of childhood innocence and education. They are denied a life of dignity, having been born into and conditioned by a life of poverty.

The miserable plight of Saheb-e-Alam and Mukesh brings out the grinding poverty and traditions which condemn children to a life of exploitation. It also spells out the callousness of the society towards the underprivileged.

Saheb, a ragpicker, was a young boy who had been denied education and was engaged in ragpicking as a profession. Mukesh was a bangle maker, born into the bangle-making legacy of his poor family. He, however, nurtures dreams of becoming a motor mechanic someday. Through examples of these slum children, constricted by the narrow bounds of poverty and child labour, the author voices the relevant concerns of societal evils.

 

Here we are providing NCERT Solutions for Class 11 English Snapshots Chapter 3 Ranga’s Marriage. Students can get Class 11 English Ranga’s Marriage NCERT Solutions, Questions and Answers designed by subject expert teachers.

Ranga’s Marriage NCERT Solutions for Class 11 English Snapshots Chapter 3

Ranga’s Marriage NCERT Text Book Questions and Answers

Question 1.
Comment on the influence of English – the language and the way of life – on Indian life as reflected in the story. What is the narrator’s attitude to English?
Answer:
The narrator has very poignantly brought out the influence of English language on the way of life in the story. As the title reflects, it is not Vivaha but “marriage” because Ranga, having had the opportunity to go for higher education to Bangalore is to an extent influenced by the West and he could talk in English. Ranga’s homecoming was a great event. People rushed announcing his arrival and went to look at him.

Unlike the people in the village, Ranga said he would not get married immediately but would wait and find the right girl to get married to. He quoted the example of an officer who got married six months back when he was about thirty and his wife, twenty-five. He liked the idea of marrying a mature girl who would understand him, unlike a childish bride. Quoting the classic tale of Shakuntala, he said that Dushyantha would not have fallen in love with Shakuntala if she were young. He said that a man should marry a girl he admires and it would be impossible to admire an immature girl.

Question 2.
Astrologers’ perceptions are based more on hearsay and conjecture than what they learn from the study of the stars. Comment with reference to the story.
Answer:
Astrologers’ perceptions are based more on tittle-tattle and assumption than what they learn from the study of the stars. This is brought out effectively through the character of a Shastri in the story. The narrator told the Shastri about his ploy to bring Ranga and Ratna together before he took Ranga to him. As planned, the Shastri pretended to make certain calculations and said that his problem had something to do with a girl.

He added that the name of the girl was something found in the ocean such as Kamala (the lotus), Pachchi, (the moss) or Ratna (the precious stone). The narrator said that the girl in Rama Rao’s house was Ratna. The Shastri was very positive about the proposal working out. Later that . evening, the narrator joked with the Shastri about his predictions based on the information he gave but Shastri did not like it. He said “…Don’t forget, I developed on the hints you had given me.”

Question 3.
Indian society has moved a long way from the way the marriage is arranged in the story. Discuss.
Answer:
The Indian society has certainly moved a long way from the way the marriage is arranged in the story. In the story, firstly, Ratna is a child of eleven. The marriage of a girl of this age is now a criminal offense. Ranga falls in love with Ratna, who is no more than a child when he hears her sing. Unlike the story, marriages are arranged but based on compatibility and maturity of the couple. The predictions of an astrologer, like the Shastri in the story, are no longer the gospel truth. Mutual consent of the couple is given more importance than that of the matchmakers, like the narrator.

Question 4.
What kind of a person do you think the narrator is?
Answer:
The narrator is an affable man who is intelligent and a keen observer. He notices Ranga’s expressions of delight and disappointment and deals with the situation accordingly. He is proud of his roots and talking of his village he says, “I am not the only one who speaks glowingly of Hosahalli.” He does not like the idea of people aping the West blindly. He talks disparagingly of them, “they are like a flock of sheep.

One sheep walks into a pit, the rest blindly follow it.” The influence of English, on the native language, too meets with criticism—“What has happened is disgraceful, believe me.” Ranga’s western concepts of marriage, too, do not appeal to him. He feels “distressed (as) the boy who (he) thought would make a good husband, had decided to remain a bachelor.” But he anyway decides to play matchmaker and arrange Ranga’s marriage.

His curiosity to know what the people were up to when they went to Ranga’s house makes him follow them. He writes, “Attracted by the crowd, I too went and stood in the courtyard.” A traditionalist by nature he is happy to note that,Ranga “bent low to touch my feet.” However, he knows how to use situations to his advantage. He decides that Ratna is just the right girl for Ranga. He plots a situation, wherein Ranga hears her sing and falls in love with her. Then, he takes him to the Shastri who has been tutored by him. He is a traditionalist but a well-meaning person. He takes onto himself the responsibility of getting Ranga married and sees it through.

NCERT Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance

These Solutions are part of NCERT Solutions for Class 12 Biology. Here we have given NCERT Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance

Question 1.
Group the following as nitrogenous bases and nucleosides:
Adenine, cytidine, thymine, guanosine, uracil, and cytosine.
Solution:
Adenine, Guanosine, Thymine, Uracil, and Cytosine are nitrogenous bases. (Adenine and Guanosine → Purine, Thymine, Uracil and Cytosine → Pyrimidine) Cytidine is a nucleoside.

Question 2.
If a double-stranded DNA has 20 percent of cytosine, calculate the percent of adenine in the DNA.
Solution:
According to Chargaff’s rule, in a double-stranded DNA, the total number of cytosine molecules will be equal to the number of guanine molecules and the number of adenine molecules will be equal to the number of thymine molecules. Therefore, if a double-stranded DNA has 20 percent of cytosine then the guanine will also be 20 per cent. The remaining 60% will consist of adenine and thymine in equal amount. Thus adenine will be 30%.

Question 3.
If the sequence of one strand of DNA is written as follows:
5′-ATGCATGCATGCATGCATGCA
TGCATGC-3′
Write down the sequence of complementary strand in 5′ -> 3′ direction.
Solution:
5′-GCATGCATGCATGCATGCAT G C ATG CAT-3′.

Question 4.
If the sequence of the coding strand in a transcription unit is written as follows: 5′-ATGCATGCATGCATGCATGCATGCATGC-3′ Write down the sequence of mRNA.
Solution:
If the sequence of coding strand is :
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
Then template strand is :
3′ – TACGTACGTACGTACGTACGTACGTACG – 5′
The mRNA will be formed on the template strand in 5′ —> 3’ direction. Thus mRNA sequence will be:
5′-AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3′
Thymine in DNA is substituted by uracil in RNA.

Question 5.
Which property of DNA double helix led Watson and Crick to hypothesise a semi-conservative mode of DNA replication? Explain.
Solution:
The two strands of DNA show complementary base pairing. This property of DNA led Watson and Crick to suggest a semi-conservative mechanism of DNA replication in which one strand of a parent is conserved while the other complementary strand formed is new.

Question 6.
Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid polymerases
Solution:
DNA dependent DNA polymerases and DNA dependent RNA polymerases.

Question 7.
How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic
material?
Solution:
They raised 2 types of bacteriophages

• On radioactive phosphorous (³²P)
• On radioactive sulphur (³⁵S).

³⁵S gets into protein and ³²P into DNA When both bacteriophages infected bacteria differently and by shaking them, the viral protein coat was separated

After raising these bacteria it was found that those infected with ³²P bacteriophage → radioactivity were found. But with ³⁵S → no radioactivity was found.

Question 8.
Differentiate between the following:

1. Repetitive DNA and Satellite DNA
2. Template strand and Coding strand
3. mRNA and tRNA

Solution:

1. Differences between repetitive DNA and satellite DNA are as follows:
   
   
2. Differences between template strand and coding strand are as follows:
   
   
3. Differences between mRNA and tRNA are as follows:
   
   
   
   

Question 9.
List two essential roles of ribosome during translation
Solution:
Two essential roles of the ribosome during translation are:

1. One of the RNA acts as a peptidyl transferase ribozyme for the formation of peptide bonds.
2. The ribosome provides sites for attachment of mRNA and charged tRNA for polypeptide synthesis.

Question 10.
In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?
Solution:
The lac operon is regulated by the amount of lactose in the medium where the bacteria are grown. When the amount of lactose is exhausted in the medium, the lac operon shuts down.

Question 11.
Explain (in one or two lines) the function of the followings:

1. Promoter
2. tRNA
3. Exons

Solution:

1. Promoter: It is located at the 5′ end of the transcription unit and provides site for attachment of transcription factors (TATA Box) and RNA polymerase.
2. tRNA: It takes part in the transfer of activated amino acids from cellular pool to ribosome so that they can take part in protein formation.
3. Exons: In eukaryotes, DNA is mosaic of exons and introns. Exons are coding sequences of DNA which are both transcribed and translated.

Question 12.
Why is the Human Genome Project called a mega project?
Solution:
The human genome was a megaproject that aimed to sequence every base in the human genome. The estimated cost of the project would be a billion (1 billion = 100 crores) US dollars.

Question 13.
What is DNA fingerprinting? Mention its application.
Solution:
DNA fingerprinting is the identification of differences in specific regions of DNA sequences based on DNA polymorphism, repetitive DNA, and satellite DNA.
Application of DNA fingerprinting: Settling, paternity disputes and identity of criminal by different DNA profiles in forensic laboratories.

Question 14.
Briefly describe the following:

1. Transcription
2. Polymorphism
3. Translation
4. Bioinformatics

Solution:
1. Transcription – It is the process of copying genetic information from the anti-sense or template strand of the DNA into RNA. It is meant for taking the coded information from DNA in nucleus to the site where it is required for protein synthesis. Principle of complementarity is used even in transcription. The exception is that uracil is incorporated instead of thymine opposite adenine of template. The segment of DNA that takes part in transcription is called transcription unit. It has three components

• • a promoter,
  • the structural gene and
  • a terminator.

2. Polymorphism – It is the variation at genetic level, arisen due to mutations. Such variations are unique at particular site of
DNA. They occur approximately once in every 500 nucleotides or about 107 times per genome. These are due to deletions, insertions, and single-base substitutions. These alterations in healthy people, occur in non-coding regions of DNA and do not code for any protein but are heritable. The polymorphism in DNA sequences is the basis of genetic mapping of human genome as well as DNA fingerprinting.

3. Translation – It is the mechanism by which the triplet base sequence of mRNA guides the linking of a specific sequence of amino acids to form a polypeptide chain (protein) on ribosomes in the cell cytoplasm. All the protein that a cell needs are synthesised by the cell within itself.
The raw materials required in protein synthesis are ribosomes, amino acids, mRNA, tRNAs and amino acyl tRNA synthetase. Mechanism of protein synthesis involves following steps:

• • Activation of amino acids
  • Charging or aminoacylation of tRNA
  • Initiation
  • Elongation (Polypeptide chain formation)
  • Termination

The ribosomes move along the mRNA ‘reading’ each codon in turn. Molecules of transfer RNA (tRNA), each bearing a particular amino acid, are brought to their correct positions along the mRNA, molecule base pairing occurs between the bases of the codons and the complementary base triplets of tRNA. In this way, amino acids are assembled in the correct sequence to form the polypeptide chain.

4. Bioinformatics – Bioinformatics is the combination of biology, information technology and computer science. Basically, bioinformatics is a recently developed science which uses information technology to understand biological phenomenon. It broadly involves the computational tools and methods used to manage, analyse and manipulate volumes of biological data.

We hope the NCERT Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance help you. If you have any query regarding NCERT Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance, drop a comment below and we will get back to you at the earliest.

NCERT Solutions for Class 12 Biology Chapter 11 Biotechnology: Principles and Processes

These Solutions are part of NCERT Solutions for Class 12 Biology. Here we have given NCERT Solutions for Class 12 Biology Chapter 11 Biotechnology : Principles and Processes

Question 1.
Make a chart (with diagrammatic representation) showing a restriction enzyme, the substrate DNA on which it acts, the site at which it cuts DNA and the product it produces.
Solution:
Restriction enzyme – Eco RI
Source – Escherichia coli RY13

Question 2.
Can you list 10 recombinant proteins which are used in medical practice? Find out where they are used as therapeutics.
Solution:
The proteins produced through rDNA technology and being used in the medical practice include rh-Growth Hormone, r-Human insulin, Erythropoietin, Follicle stimulating hormone, Interferon, Insulin-like growth factor, Tissue Plasminogen Activator, factor VIII, DNase, the Envelope protein of hepatitis B virus.

Question 3.
From what you have learned, can you tell whether enzymes are bigger or DNA is bigger in molecular size? How did you know?
Solution:
Enzymes are bigger than DNA as they are proteins and proteins are macromolecules made of amino acids which are bigger than nucleotides. This can also be proved by gel electrophoresis, where denatured protein would not move but denatured DNA will move to a distance. Protein synthesis is regulated by small portions of DNA, called genes.

Question 4.
What would be the molar concentration of human DNA in a human cell? Consult your teacher.
Solution:
The average molecular weight of a nucleotide in human DNA is 130.86. The molecular weight of human DNA will therefore be 6 x 10⁹ nucleotides (based on the human genome project) x 130-86 = 784-56 x 109 gm/mol. The molar concentration of DNA can be calculated accordingly.
The molarity can be calculated as
Molar Concentration = \(\frac { No. of molecules }{ Molecular Weight }\)

Question 5.
Do eukaryotic cells have restriction endonucleases? Justify your answer.
Solution:
Restriction enzymes also called ‘the molecular scissors’ are used to break DNA molecules. These enzymes are present in many bacteria where they function as a part of their defence mechanism called a restriction-modification system. The molecular basis of this system was explained first by W. Arber in 1965. The restriction-modification system consists of two components;

A restriction enzyme which identifies the introduced foreign DNA and cuts into pieces and is called restriction endonuclease,

The second component is a modification enzyme in which methylation is done. Once a base in a DNA sequence is modified by the addition of a methyl group, the restriction enzymes fail to recognise and could not cut that DNA. This is how a bacterium modifies and therefore, protects its own chromosomal DNA from cleavage by these restriction enzymes. Eukaryotic cells do not have restriction endonucleases (or restriction-modification system). The DNA molecules of eukaryotes are heavily methylated by a modification enzyme, called methylase. Eukaryotes exhibit some different mechanisms to counteract viral attacks.

Question 6.
Besides better aeration and mixing properties, what other advantages do stirred tank bioreactors to have over shake flasks?
Solution:
Shake flask is used for growing microbes and mixing the desired materials on a small scale in the laboratory. However, the large-scale production of a desired biotechnological product requires large stirred tank bioreactors.
Besides better aeration and mixing properties, bioreactors have the following advantages:

• It has an oxygen delivery system.
• It has a foam control, temperature, and pH control system.
• Small volumes of culture can be withdrawn periodically.

Question 7.
Collect 5 examples of palindromic DNA sequences by consulting your teacher. Better try to create a palindromic sequence by following base-pair rules.
Solution:
palindromes in DNA are base pair sequences that are the same when read forward (left to right) or backward (right to left) from a central axis of symmetry. For example, the following sequences read the same on the two strands in the 5′ → 3′ direction as well as 3′ → 5′ direction.

1. 5′ – G – G – A – T – C – C – 3′
   3′ – C – C – T – A – G – G – 5′
2. 5′ – G – A – A – T – T – C – 3′
   5′ – C – T – T – A – A – G – 5′
3. 5′ – A – A – G – C – T – T – 3′
   3′ – T – T – C – G – A – A – 5′
4. 5′ – G – T – C – G – A – C – 3′
   3′ – C – A – G – C – T – G – 5′
5. 5′ – A – C – T – A – G – T – 3′
   3′ – T – G – A – T – C – A – 5′

Question 8.
Can you recall meiosis and indicate at what stage recombinant DNA is made?
Solution:
A recombinant DNA is made in the pachytene stage of prophase I by crossing over during meiosis cell division. Recombination nodules are visible in a synaptonemal complex in the pachytene sub-stage. Crossing over occurs in this time between chromatids than recombinant DNA is formed.

Question 9.
Can you think and answer how a reporter enzyme can be used to monitor the transformation of host cells by foreign DNA in addition to a selectable marker?
Solution:
Transformation is a process through which a piece of DNA is introduced into a host bacterial cell. Normally, the genes encoding resistance to antibiotics such as ampicillin, tetracycline, etc., are considered useful selectable markers to differentiate between transformed and non-transformed bacterial cell. In addition to these selectable markers, an alternative selectable marker has been developed to differentiate transformed and non-transformed bacterial cell on the basis of their ability to produce colour in the presence of a chromogenic substance.

A recombinant DNA is inserted in the coding sequence of an enzyme (5-galactosidase (reporter enzyme). If the plasmid in the bacterium does not have an insert, the presence of a chromogenic substance gives blue coloured colonies, presence of insert results into insertional inactivation of (3-galactosidase and, therefore, the colonies do not produce any colour, these colonies are marked as transformed colonies.

Question 10.
Describe briefly the following :
(a) Origin of replication
(b) Bioreactors
(c) Downstream processing
Solution:

(a) Origin of Replication (Ori):- It is a DNA sequence which is specialised to initiate replication Bacterial chromosomes and plasmids possess a single origin of replication Eukaryote chromosomes to have a number of origin of replication. Replication proceeds bidirectionally from the site of origin of replication. The sequence also possesses nearby replication control which determines the number of copies it would form. Therefore the selected plasmid should have an origin of replication that supports a high copy number.

(b) Bio-Reactor:
Bio reactor used in biotechnology is generally 100-1000 litre cylindrical metal. container with a curved base to facilitate mixing of contents. The culture medium containing all nutrients, salts vitamins, hormones etc. is added along with the inoculum of transformed cells with recombinant DNA. A stirrer helps in mixing and optimum availability of nutrients to culture cells. The supply of oxygen is maintained if the cells function better under aerobic conditions. Foam is kept under control. Gadgets are attached for knowing the temperature and pH of the contents. Corrections are made when required. There is a sampling port where a small volume of culture can be withdrawn to know the growth of cells and concentration of the extractable product.

(c) Downstream processing:
It is the recovery of product from fully grown genetically modified cells, its purification, and preservation. It is carried out after the sampling report indicates the completion of the biosynthetic phase and the presence of the optimum product in the cells. After leaving a part of the cellular mass of inoculum, the rest is crushed and chemically treated to separate the product. The separated product is purified and then formulated with suitable preservatives. Clinical traits are carried out to know its use and any immediate or long-term adverse effect. Every batch of the product has to pass through strict quality control testing. Of course, the procedure and vigour of downstream processing and quality control vary from product to product.

Question 11.
Explain briefly
(a) PCR
(b) Restriction enzymes and DNA
(c) Chitinase
Solution:
(a) Polymerase chain reaction (PCR) is a technique of synthesizing multiple copies of the desired gene (DNA) in vitro. This technique was developed by Kary Mullis in 1985. It is based on the principle that a DNA molecule, when subjected to high temperature, splits into two strands due to denaturation. These single-stranded molecules are then converted to double-stranded molecules by synthesising new strands in presence of enzyme DNA polymerase. Thus, multiple copies of the original DNA sequence can be generated by repeating the process several times. The basic requirements of PCR are, DNA template, two nucleotide primers usually 20 nucleotides long, and enzyme DNA polymerase which is stable at high temperature (usually Taq polymerase):
The working mechanism of PCR is as follows:

First of all, the target DNA (DNA segment to be amplified) is heated to high temperature (94 to 96° C). Heating results in the separation of two strands of DNA. Each of the two strands of the target DNA now acts as a template for the synthesis of a new DNA strand. This step is called denaturation.

Denaturation is followed by annealing. During this step, two oligonucleotide primers hybridise to each single-stranded template DNA in presence of excess synthetic oligonucleotides. Annealing is carried out at lower temperatures (40° – 60°C).

The third and final step is an extension. During this step, the enzyme DNA polymerase synthesizes the DNA segment between the primers. Usually, Taq DNA polymerase, isolated from a thermophilic bacterium Thermus aquatics, is used in most cases. The two primers extend towards each other in order to copy the DNA segment lying between the two primers. This step requires the presence of deoxynucleoside triphosphates (dNTPs) and Mg²⁺ and occurs at 72°C.
The above-mentioned three steps complete the first cycle of PCR. The second cycle begins with denaturation of the extension product of the first cycle and after completing the extension step, two cycles are completed. If these cycles are repeated many times, the DNA segment can be amplified approximately a billion times, i.e., one billion copies of desired DNA segment are made.

(b) Restriction enzymes are used to break DNA molecules. They belong to a larger class of enzymes called nucleases. Restriction enzymes are of three types – exonucleases, endonucleases, and restriction endonucleases.

Exonucleases: They remove nucleotides from the terminal ends (either 5′ or 3′) of DNA in one strand of the duplex.

Endonucleases: They make cuts at specific positions within the DNA. These enzymes do not cleave the ends and involve only one strand of the DNA duplex.

Restriction endonucleases: These were found by Arber in 1963 in bacteria. They act as “molecular scissors” or chemical scalpels. They recognise the base sequence at palindrome sites in the DNA duplex and cut its strands. Three main types of restriction endonucleases are type I, type II, and Type III. Out of the three types, only type II restriction enzymes are used in recombinant DNA technology because they can be used in vitro to recognise and cut within specific DNA sequences typically consisting of 4 to 8 nucleotides.

(c) Chitinase is a lysing enzyme that dissolves the fungal cell wall. It results in the release of DNA along with several other macromolecules.

Question 12.
Discuss with your teacher and find out how to distinguish between:
(a) Plasmid DNA and chromosomal DNA
(b) Exonuclease and endonuclease
(c) RNA and DNA
Solution:
(a) Plasmid DNA is naked double-stranded DNA that forms a circle with no free ends. It is associated with few proteins. It is smaller than the host chromosome and can be easily separated.

Chromosomal DNA is a double-stranded linear DNA molecule associated with large proteins. This DNA exists in relaxed and supercoiled forms and provides a template for replication and transcription. It has free ends.

(b) Differences between exonucleases and endonucleases are as follows :

(c) Differences between DNA and RNA are given in the following table:

We hope the NCERT Solutions for Class 12 Biology Chapter 11 Biotechnology: Principles and Processes help you. If you have any query regarding NCERT Solutions for Class 12 Biology Chapter 11 Biotechnology: Principles and Processes, drop a comment below and we will get back to you at the earliest.