Category: CBSE Sample Papers

Students can access the CBSE Sample Papers for Class 12 Hindi with Solutions and marking scheme Term 2 Set 2 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Hindi Term 2 Set 2 with Solutions

Time Allowed: 2 Hours
Ma×imum Marks: 40

सामान्य निर्देश :

• निम्नलिखित निर्देशों को बहुत सावधानी से पढ़िए और उनका पालन कीजिए:
• इस प्रश्न पत्र में वर्णनात्मक प्रश्न पूछे गए हैं।
• इस प्रश्न पत्र में कुल सात प्रश्न पूछे गए हैं। आपको सात प्रश्नों के उत्तर देने हैं।
• प्रश्नों में आंतरिक विकल्प भी दिए गए हैं। निर्देशानुसार उत्तर दीजिए।

कार्यालयी हिंदी और रचनात्मक लेखन [20 अंक]

प्रश्न 1.
निम्नलिखित दिए गए तीन शीर्षको में से किसी एक शीर्षक का चयन कर लगभग 200 शब्दों में एक रचनात्मक लेख लिखिए: (5 × 1 = 5)
(क) बारिश बिन छतरी
उत्तरः
बारिश बिन छतरी:
मुझे याद है 15 जुलाई, 2020 का वह ऐतिहासिक दिन जो अविस्मरणीय घटना के रूप में मेरे मानस पटल पर मेरी अंतिम साँस तक अटल रहेगा। शुक्रवार का दिन था। सवेरे सात बजे मैं घर से स्कूल के लिए निकला। आसमान पर बादलों का नामोनिशान तक नहीं था। माँ ने मुझे कहा था की छाता ले जाओ पर मैंने मना कर दिया। हर बार बरसात के मौसम में एक दो छाते मेरी लापरवाही की वजह से किसी और का भला कर रहे होते। मैं घर से निकला ही था की अचानक बादलों ने मेरे सिर पर छाता तान दिया। मैं जितना आगे बढ़ता जाता बादल भी उसी गति से मेरा पीछा करते जा रहे थे। मुझे ऐसा लग रहा था कि माँ की बात न मानने की सजा बादल मुझे दे रहे हैं। मुझे ऐसा लग रहा था कि वे मेरे घर से निकलने का ही इंतजार कर रहे थे। मुझे स्कूल के लिए देर हो रही थी इसलिए मैं कहीं शरण भी नहीं ले सकता था। भीगते-भीगते मैं स्कूल पहुँच तो गया पर गीले कपड़ों में मुझे ठण्ड लगने लगी थी। आज पहले कालांश में गणित का टेस्ट और था। कंगाली में आटा गीला होने वाली बात हो गई थी। गणित का भार भी मुझे बिना वजह ढोना पड़ता था। गणित भी मेरे लिए भूतप्रेत से कम नहीं है। गणित के शिक्षक के सामने मेरी जुबान भी नहीं खुलती थी। पर उनके देखने मात्र से ही मेर कपड़े सूख गए। उस दिन मेरा टेस्ट नहीं हुआ। अगले दिन स्कूल जाने का मेरा बिल्कुल मन नहीं था पर माँ ने कहा कि गणित के शिक्षक ने उन्हें फोन किया था कि मुझे आज टेस्ट देने के लिए स्कूल जाना होगा। मन मारकर मैं गया और टेस्ट दिया।

(ख) सैर के दौरान घटी हुई घटना
उत्तरः
सैर के दौरान घटी हुई घटना:
अभी पिछले सप्ताह की बात है। मैंने अपने दो मित्रों के साथ आमेर घूमने का कार्यक्रम बनाया। नियत समय पर हम लोग गाड़ी लेकर निकल पड़े। मौसम भी सुहाना था। धूप-छाँव की स्थिति थी। मंद-मंद हवा चल रही थी। खाते-पीते गाना गाते हम आमेर के रास्ते पर चल पड़े। बातें करते-करते हम कब आमेर पहुँच गए इसका पता ही नहीं चला। वहाँ पहुँच कर हमने निश्चय किया कि आमेर मंदिर तक का रास्ता गाड़ी से ही तय करेंगे। अबकी बार ड्राइविंग करने का निर्णय मैंने लिया। मैं बड़े धीरे-धीरे और सावधानी से गाड़ी को चढ़ाई पर ले जा रह था। अचानक ही जोर के धक्के से गाड़ी रुक गई और नीचे की ओर जाने लगी। हम सब घबरा गए। मैंने जल्दी से हैण्ड ब्रेक खींचा ओर गाड़ी को नीचे जाने से रोका। हम सभी मित्रों के चेहरे पर चिंता के भाव स्पष्टतया नजर आने लगे थे। हमारी गाड़ी को रुका हुआ देखकर पुलिस का एक सिपाही हमारे पास आया और उसने हमारी चिंता का कारण पूछा। हमारे बताते ही उन्होंने हमें नीचे उतरने को कहा और स्वयं इंजन का निरीक्षण करने लगे। पाँच मिनट बाद ही गाड़ी का इंजन शुरू हो गया। हमने उनका धन्यवाद किया और बढ़ चले आगे की ओर। बस कुछ ही पलों में हम मंदिर के सामने थे। वहाँ हमने दर्शन किए और फिर खब मजे किए। शाम को चार बजे हम अपने घर लौट आये।

(ग) सफर में बस का टायर पंक्चर होना
उत्तरः
सफर में बस का टायर पंक्चर होना:
गत वर्ष मेरे ममेरे भाई की शादी थी। नवम्बर का महीना था। उस महीने में शादियाँ बहुत थीं इसलिए रेलगाड़ी में आरक्षण मिला नहीं सो हमने बस से जाने का निश्चय किया। मैं, मेरा छोटा भाई, माताजी, पिताजी और दादाजी, हम सब नियत दिन बस से यात्रा करने के लिए बस स्टैंड पहुँच गए। बस चलने का समय शाम 6 बजे का था और सात बजे तक वह वहां से चली ही नहीं। लगभग सवा सात बजे बस लखनऊ के लिए रवाना हुई। 9 बजे बस एक स्थान पर रुकी। वहां पर हमने खाना खाया। साढ़े नौ बजे बस गंतव्य के लिए रवाना हुई। हमें नींद आने लगी थी। बस के सभी यात्री ऊंघने लगे थे। बस में हिचकोले खाते हुए सोने का मजा ही कुछ ओर है। अचानक हिचकोले आने बंद हो गए। आँख खुली तो देखा कि बस रुकी हुई है। खिड़की से बाहर झाँका तो दूर तक बीहड़ वन और अँधेरे के खाना अलावा कुछ भी नजर नहीं आ रहा था। आधा घंटा हो चुका था और बस रवाना ही नहीं हुई थी। ड्राइवर ने बताया कि टायर पंक्चर हो गया है। सर्दी बढ़ती जा रही थी और साथ-साथ हमारे मन की घबराहट भी क्योंकि ड्राइवर ने बताया कि नए टायर का इंतजाम सुबह तक ही हो पायेगा इसलिए सबको बस में ही रात गुजारनी होगी। वन में और बस में रात बिताने का यह नितांत नया अनुभव था। खैर सोते जागते ऊँघते किसी तरह रात गुजरी और सुबह की किरण एक नयी आशा के साठ आई। बस का टायर बदला गया और हम अपने गंतव्य पहुंचे।

प्रश्न 2.
आप राजकीय उच्च माध्यमिक विद्यालय, आगरा में कक्षा 10 में पढ़ने वाले अनुज हैं। आपकी कक्षा में एक महीने से गणित की पढ़ाई नहीं हो पा रही है। इसकी जानकारी देते हुए प्रधानाचार्या जी को पत्र लिखिए।
अथवा
आपके नगर के चिकित्सालय में एक ही चिकित्सक होने के कारण रोगियों को बड़ी ही असुविधा का सामना करना पड़ रहा है। इसकी जानकारी देते हुए प्रान्त के
चिकित्सा विभाग के सचिव को पत्र लिखिए। (5)
उत्तरः
सेवा में
प्रधानाचार्या महोदय
राजकीय उच्च माध्यमिक विद्यालय
आगरा
दिनांक: 4 अक्टूबर 20XX
विषय: गणित विषय की पढ़ाई में व्यवधान की जानकारी देने हेतु।
महोदय
निवेदन है कि मैं आपके विद्यालय के कक्षा दस का छात्र हूँ। हमारी कक्षा में पिछले एक महीने से गणित की पढ़ाई नहीं हो रही है। ज्ञातव्य है कि हमारे गणित के अध्यापक श्रीमान् रमेश पाण्डेय जी का गत महीने एक्सीडेंट हो गया था। इस कारण वह विद्यालय आने में असमर्थ हैं। तभी से हमारी गणित की पढ़ाई में व्यवधान आ गया है। आपने इसकी पूर्ति के लिए वैकल्पिक व्यवस्था करते हुए श्रीमान सुरेश जी को हमारी कक्षा का भार सौंपा था। वे पूरे मनोयोग से पढ़ा रहे थे और विद्यार्थी भी उनसे संतुष्ट थे पर अचानक ही उनकी माताजी को हृदयाघात आने से वे भी अवकाश पर चले गए हैं। इस प्रकार हमारी पढ़ाई में फिर से व्यवधान आ गया। ज्ञातव्य है कि हमारी अर्धवार्षिक परीक्षाएँ भी अगले महीने हैं।
अतः मेरी आपसे करबद्ध विनती है कि आप हमारी इस समस्या पर ध्यान देते हुए हमारी पढ़ाई की कोई उचित व्यवस्था करें और अतिरिक्त कक्षा लगवाने की व्यवस्था करें जिससे हमें अध्ययन में किसी प्रकार की रूकावट न आए। आशा है आप मेरी बात को समझेंगे और इस पर तुरंत कार्यवाही करेंगे।
धन्यवाद।
आपका आज्ञाकारी शिष्य
क.ख.ग.
कक्षा : दसवीं ‘अ’

अथवा

4, दुर्गापुरा रोड
जयपुर।
दिनांक: 4 अक्टूबर 20XX
सचिव महोदय
स्वास्थ्य मंत्रालय
राजस्थान सरकार
जयपुर
विषय: चिकित्सकों के अभाव की जानकारी देने हेतु।
महोदय
इस पत्र के माध्यम से मैं आपका ध्यान हमारे क्षेत्र के चिकित्सालय की ओर दिलाना चाहता हूँ। हमारे शहर में हर नागरिक को सारी सुविधाएँ प्राप्त हो रही हैं। पर एक मुख्य समस्या का सामना यहाँ के निवासियों को करना पड़ रहा है और वह है चिकित्सालय में चिकित्सकों का अभाव।
हमारे इलाके में जो सरकारी चिकित्सालय है उसमें सभी आधुनिक सुख सुविधाएँ हैं पर वहाँ केवल एक चिकित्सक के होने के कारण रोगियों को बड़ी ही असुविधा होती है। उनको दिखाने के लिए बड़ी ही लम्बी लाइन लगती है और अनेक बार ऐसा होता है कि कई रोगियों को तो बिना दिखाए ही निराश होकर लौटना पड़ता है। विवश होकर उन्हें स्वयं को प्राइवेट अस्पताल में दिखाना पड़ता है। वहाँ का खर्चा इतना होता है कि बेचारे निर्धन वर्ग वाले तो वहाँ जा भी नहीं पाते।
अतः आपसे निवेदन है कि आप हमारी समस्या को समझेंगे और हमारे इलाके में दो नए चिकित्सकों की नियुक्ति करेंगे जिससे किसी भी मरीज को चिकित्सालय से निराश होकर नहीं लौटना पड़े।
धन्यवाद सहित।
प्रार्थी
क.ख.ग.

प्रश्न 3.
(क) नाटक में कथावस्तु के महत्व को प्रतिपादित कीजिए।
अथवा
कहानी के इतिहास पर प्रकाश डालिए। (3)
उत्तरः
नाटक में कथावस्तु का बहुत महत्व है। वास्तव में कथावस्तु को ‘नाटक’ की संज्ञा दी गई है। इसे अंग्रेजी में ‘प्लाट’ कहते हैं। कथा सभी रचनाओं की रीढ़ होती है इसलिए यह सभी प्रबंधात्मक रचनाओं में अनिवार्य है। भारतीय आचार्यों द्वारा नाटक में तीन प्रकार की कथाओं का निर्धारण किया है प्रख्यात, उत्पाद्य और मिस्र प्रख्यात कथा। इतिहास, पुराणों से प्राप्त कथा प्रख्यात कथा होती है और कल्पना पर आश्रित कथा उत्पाद्य कथा होती है। मिस्र प्रख्यात कथा में इतिहास और कल्पना दोनों का ही योग होता है। इनके आधारों पर नाटक कथा को मुख्य, गौण और प्रासंगिक भागों में बाँटा गया है। प्रासंगिक के दो भाग पताका और प्रकरी हैं। पताका मुख्य कथा के साथ-साथ चलती है और प्रकरी बीच में ही समाप्त हो जाती है नाटक को अपनी कथावस्तु की योजना में पात्रों और घटनाओं में इस प्रकार संगति बैठानी होती है कि पात्र अपने अभिनय के साथ न्याय कर सकें।
अथवा
कहानी का इतिहास उतना ही पुराना है जितना मानव इतिहास। कहानी मानव स्वभाव और प्रकृति का अंग है। जैसे-जैसे आदिम मानव ने अपना विकास आरम्भ किया वैसे-वैसे ही कहानी ने अपना विकास किया। कथावाचक कथा सुनाते थे। उनकी कथा का कथानक युद्ध, प्रेम और प्रतिशोध आदि के किस्से होते थे। मानव मन कल्पना के सागर में गोते लगाता है इसलिए उसकी कथाओं में कल्पनाओं का भंडार होता था। सच्ची घटनाओं पर आधारित कहानी सुनाते-सुनाते मनुष्य उसमें कल्पनाओं का मिश्रण करने लगा। इसका प्रमुख कारण यह था कि मनुष्य को अच्छा लगता है, वह उसे ही सुनना चाहता है। प्राचीनकाल से कहानी ने विराट स्वरूप धारण कर लिया था क्योंकि पूर्व समय में इसके अतिरिक्त मनोरंजन का कोई और साध न नहीं था। इस प्रकार कहानी प्राचीन समय से आज तक अपना प्रभुत्व जमाए हुए है।

(ख) कविता अन्य कलाओं की तरह सिखाई क्यों नहीं जा सकती?
अथवा
रेडियो नाटक और सिनेमा में मुख्य अंतर क्या (2)
उत्तरः
कविता अन्य कलाओं की तरह सिखाई नहीं जा सकती। चित्रकला में रंग, कूची, कैनवास और संगीत में वाद्य यंत्र, स्वर, ताल आदि की आवश्यकता पड़ती है परन्तु कविता में किसी बाह्य उपकरण की आवश्यकता भी नहीं होती और न ही किसी बाह्य उपकरण की मदद ली जा सकती है। कवि के सामने एक प्रमुख समस्या यह भी होती है कि उसकी सीमा केवल शब्दों तक ही निर्धारित होती है। उसे अपनी इच्छानुसार ही शब्दों को जुटाकर उसे लयबद्ध करना होता है इसलिए अन्य कलाओं की तरह इसे सिखाया नहीं जा सकता।
अथवा
रेडियो नाटक और सिनेमा में सबसे बड़ा अंतर यह है कि जहाँ रेडियो पूरी तरह से श्रव्य माध्यम है वहीं सिनेमा श्रव्य और (दृश्य दोनों है। इस आधार पर रेडियो नाटक इनसे भिन्न भी है और मुश्किल भी। रेडियो नाटक में सब कुछ संवादों और ध्वनि प्रभावों के आधार पर संप्रेषित किया जाता है। वहाँ न तो मंच सज्जा है और न ही वस्त्र सज्जा। सब कुछ जैसा था, वैसा ही रह जाता है। कहानी की शुरुआत मध्य-अंत, परिचय-द्वंद्व-समाधान आदि सब कुछ केवल ६ वनि और संवादों के आधार पर ही संप्रेषित योग्य होता है।

प्रश्न 4.
(क) बाढ़ की भयानक विभीषिका विषय पर रिपोर्ट लिखिए।
अथवा
‘बचपन की पढ़ाई लक्ष्य का सोपान’ विषय पर आलेख लिखिए। (3)
उत्तरः
इस वर्ष तो बाढ़ के कारण लाखों लोग घर से बेघर हो गए। अनेक गाँव पानी में समा गए। कुछ लोग तो अन्य स्थान पर रहने वाले अपने संबंधियों के घर चले गए और कुछ लोगों ने राहत शिविर की शरण ली। राहत शिविर में रहने वाले लोगों की समस्याओं का तो कोई अंत ही नहीं है। घर से बेघर होने जैसी भयानक समस्या तो कोई हो ही नहीं सकती और जब लोगों को टेंट, शामियानों में रहने को विवश होना पड़े तो जिंदगी बद से बदतर हो जाती है। सब कुछ सामूहिक हो जाता
है।

घर से बेघर होने पर लोगों के काम-धंधे, पढ़ाई-लिखाई सब चौपट हो जाती है। बाढ़ के कारण इन स्थानों पर अनेक बीमारियाँ फैलने का खतरा बढ़ जाता है। लोगों का निजी जीवन समाप्त-सा हो जाता है। जब इन स्थानों में राहत सामग्री का वितरण होता है तो व्यक्ति खुद को भिखारी-सा समझने लगता है और उसका आत्मसम्मान नष्ट हो जाता है। राजनीतिक दलों के बड़े-बड़े लोग और कथित नेता लोग इस अवसर भी अपनी चुनावी रोटियाँ सेंकने से बाज नहीं आते। ईश्वर किसी को ऐसा दिन न दिखाए।

अथवा

प्रत्येक बच्चा कच्ची मिट्टी का वह लोंदा होता है जिसे मनचाहे आकार में ढाला जा सकता है और बचपन के अनुभव ही उसकी क्षमताओं का विकास कर उसे दुनिया में भले-बुरे का ज्ञान करवाने में सहायक होते हैं। यही बचपन की पढ़ाई निर्धारित करती है कि बच्चा बड़े होकर किस प्रकार का इन्सान बनेगा। इसके लिए हमारे देश में विद्यालयों की कमी नहीं है। ये विद्यालय ही बच्चे की सोच को विकसित कर उसे सही दिशा दिखाने में अपनी अहम भूमिका का निर्वाह करते हैं।

बच्चा एक नियत अवधि के लिए विद्यालय में रहता है। विद्यालय कंक्रीट की बनी हुई इमारत होती है जहाँ हर बच्चे को एक-सा वातावरण मिलता है और अपनी उम्र के बच्चों के साथ पढ़ने का अवसर मिलता है। जितना समय वह विद्यालय में गुजारता है उसे भी अलग-अलग कालांशों में बाँट दिया जाता है। हर विषय के लिए कालांश निर्धारित होता है। पढ़ाई के अतिरिक्त उनमें से कुछ कालांश खेल-कूद और अन्य गतिविधियों के लिए भी निर्धारित होते हैं बच्चे के लिए विशेष परिधान निर्धारित होता है और अनशासन व नियमों का पालन उसे करना पड़ता है। इससे वह अपनी जिंदगी का पहला सबक सीखता है कि दुनिया कुछ नियम-कायदों से बंधी हुई है और इसका पालन सबको करना सजा भुगतनी पड़ सकती है और इनका पालन करना आपको एक सफल मनुष्य बना सकता है। हर विद्यालय में प्रबंधन समिति द्वारा प्रत्येक कक्षा के लिए पुस्तकें निर्धारित होती हैं। इनमें कुछ तथ्य और आंकड़े होते हैं जिनका अध्ययन हर बच्चा करता है। यह बच्चे की क्षमता पर निर्भर करता है कि वह क्या और कितना सीखता है और उसे किस प्रकार अपनी दिनचर्या में शामिल करता है। उसका यही सोपान का काम करता है। जिससे वह अपने जीवन में एक सफल नागरिक बन सकता है।

(ख) ‘गाँवों से शहरों की ओर’ विषय पर आलेख लिखिए।
अथवा
गैस सिलेंडर में रिफिलिंग से हुए धमाके की घटना का समाचार लिखें। (2)
उत्तरः
आज जब सारा विश्व एक ही परिवार बनता जा रहा है तो लोग भी गाँव से शहरों की ओर पलायन कर रहे हैं पर आज भी भारत माता ग्रामवासिनी ही है। पढ़ने-लिखने के बाद आज हर युवा शहर में ही रहना चाहता है। वहाँ की चकाचौंध और सुविधाओं से भरा हुआ जीवन मनुष्य को अपनी तरफ आकर्षित करता है। इस कारण लोगों ने गांवों पर ध्यान देना कम कर दिया और वर्तमान में गाँव हीन और उजाड़ होते जा रहे हैं।

न वहाँ सड़के हैं, न परिवहन के साधन, न बिजली, न अच्छे स्कूल कॉलेज और न ही अच्छी चिकित्सा व्यवस्था। अब तो खेती करने के लिए बीज आदि सामग्री भी शहर से लानी पड़ती है। फसलें काटने के बाद उन्हें भी बेचने के लिए शहर ही जाते हैं। शहर में पक्के मकान हैं और सभी सुविधाओं का डेरा है इसलिए वहाँ गया हुआ व्यक्ति अपने मन में शहरों की ढेर सारी यादें लेकर लौटता है।

गाँव और शहर के जीवन में इतना अधिक असंतुलन नहीं होना चाहिए। सरकार को गाँवों की दशा को सुधारना चाहिए जिससे लोग वहाँ से कहीं और जाने की न सोचें।

अथवा

नोएडा, संवाददाता चौड़ा गाँव में बुधवार को छोटे सिलेंडर में गैस रिफिललग के दौरान आग लग गई। आग तीन बड़े सिलेंडरों में भी जा लगी जिससे जोरदार धमाका हुआ और दुकान की छत उड़ गई। इस घटना में कोई हताहत नहल हुआ लेकिन पड़ोसी की बिजली की एक दुकान का सारा सामान जल गया है। दुकानदारों ने एफआईआर दर्ज कराने के साथ ही प्रशासन ने भी रिफिललग करने वाले के खिलाफ रिपोर्ट दर्ज कराई है। सोनू भारद्वाज की गैस रिफिललग की दुकान में बुधवार सुबह 11 बजे पाँच किलों के सिलेंडर में रिफिललग के दौरान बर्नर की जाँच करते हुए आग लग गई। सोनू आग लगते ही मौके से भाग गया। देखते ही देखते चार सिलेंडरों में धमाके हुए और दुकान की छत उड़ गई। सूचना पर पुलिस और दमकल की गाड़ियाँ मौके पर पहुँची। दमकल की चार गाडियों ने सोनू की दूकान तथा देवेंद्र की बिजली के सामान की दुकान में लगी आग को बुझाया।

पाठ्यपुस्तक आरोह भाग-2 तथा अनुप पूरक पाठ्यपुस्तक वितान भाग-2 [20 अंक]

प्रश्न 5.
निम्नलिखित तीन प्रश्नों में से किन्हीं दो प्रश्नों के उत्तर दीजिए। (3 × 2 = 6 )
(क) फ़िराक की रुबाइयों में हिंदी का घरेलू रूप दिखाई देता है। उदाहरण द्वारा सिद्ध कीजिए।
उत्तरः
फ़िराक गोरखपुरी उर्दू के शायर हैं। उनकी रुबाइयों को पढ़कर लगता है कि उन्हें हिंदी भाषा का भी ज्ञान था। उन्होंने अपनी रुबाइयों में हिंदी भाषा के लोक प्रचलित रूपों का बहुत ही स्वाभाविक रूप से प्रयोग किया है। ‘चाँद का टुकड़ा’, ‘लोका देना’, कपड़े पिन्हाना’ आदि घरेलू हिंदी के ही उदाहरण हैं। घरेलू शब्दों के प्रयोग के कारण ही उनकी रुबाइयों को अनपढ़ व्यक्ति भी पढ़कर उनका आनंद उठा सकता है। कुछ उदाहरण के उच्चारण तो बहुत ही सुंदर बन पड़े हैं। जैसे ‘बालक तो हई चाँद पे ललचाया है।’ इस पंक्ति में ‘हई’ शब्द का उच्चारण अत्यंत ही सुंदर और स्वाभाविक है।

(ख) कविता के किन उपमान को देखकर यह कहा जा सकता है कि उषा कविता गाँव की सुबह का गतिशील शब्द चित्र है?
उत्तरः
कविता में वर्णित राख से लिखा हुआ चौका, काली सिल, स्लेट पर लाल खड़िया चाक आदि उपमानों से पता चलता है कि कवि ने गाँव के परिवेश को आधार बनाकर उषाकालीन प्रकृति का सुंदर चित्रण किया है। महानगरों में कहीं भी न तो लीपा हुआ चौका देखा जा सकता है, न ही स्लेट और न ही खड़िया चाक। सभी शब्दचित्र गाँव से संबंधित हैं। गाँव के प्रत्येक घर में प्रातः काल होने के बाद पहले चौका लीपा जाता है। ततपश्चात सील का प्रयोग होता है। और फिर कुछ देर बाद बालक को स्लेट दी जाती है। अतः यहाँ कवि ने ग्रामीण जनजीवन के गतिशील चित्र अंकित किए हैं।

(ग) शोकग्रस्त माहौल में हनुमान के अवतरण को करुण रस के बीच वीर रस का आविर्भाव क्यों कहा गया है?
उत्तरः
वैद्य सुषेण ने कहा था कि अगर प्रातः होने से पूर्व संजीवनी बूटी मिल गई तो लक्ष्मण बच सकता है अन्यथा उसकी मृत्यु हो जाएगी। अर्द्धरात्रि बीत चुकी थी और हनुमान अभी तक लौट कर नहीं आया था। संपूर्ण भालू और वानर सेना घबराई हुई थी। राम भी लक्ष्मण की मृत्यु के डर के कारण घबरा गए थे। और वे भावुक होकर विलाप करने लगे, परंतु इस बीच हनुमान संजीवनी बूटी लेकर पहुँच गए। हनुमान को देखकर राम के विलाप में आशा और उत्साह का संचार हो गया क्योंकि अब सभी को आशा बंध गई थी कि लक्ष्मण होश में आ जाएँगे और फिर रावण पर विजय प्राप्त की जा सकेगी।

प्रश्न 6.
निम्नलिखित चार प्रश्नों में से किन्हीं तीन प्रश्नों के उत्तर दीजिए (3 × 3 = 9 )
(क) मानचित्र पर एक लकीर खींच देने से ज़मीन और जनता नहीं बंट जाती- ‘नमक’ कहानी के आधार पर कथन की सत्यता सिद्ध कीजिए।
उत्तरः
कटु राजनीति के कारण देश के टुकड़े हो जाते हैं। ज़मीन तो बंट जाती है पर लोगों के मन का बँटवारा नहीं हो पाता। यह सत्य है कि मानचित्र पर एक लकीर खींच देने से हम देश को तो बाँट सकते हैं पर जमीन और जनता को नहीं बाँट सकते। भारत भी कटु राजनीति का शिकार रहा है। भारत आज पाकिस्तान और बांग्लादेश के कारण तीन टुकड़ों में बँटा हुआ है पर लोगों के दिलों में किसी भी तरह कि कोई दरार नहीं है। आज भी उनमें वही प्रेम और भाईचारा कायम है। इस कहानी में पाकिस्तानी कस्टम और भारतीय कस्टम दिल्ली और ढाका को आज भी अपना वतन मानते हैं। सिख बीबी लाहौर को अपना वतन मानती है और वहीं का नमक चाहती है। इसी प्रकार भारतीय कस्टम अधिकारी ढाका के नारियल पानी को स्वादिष्ट मानता है। वे एक दूसरे की भावनाओं की कद्र करते हैं।

(ख) आदर्श समाज की स्थापना में डॉक्टर आंबेडकर के क्या विचार थे?
उत्तरः
डॉ आम्बेडकर ने आदर्श समाज की स्थापना के लिए जन्मजात समानता का विचार दिया है। उनका मानना है कि श्रम विभाजन जन्म और जाति पर न होकर रूचि के आधार पर होना चाहिए। हम उनके इस विचार से पूर्णतया सहमत हैं। अभी तो कुछ लोग जन्म से ही स्वयं को ऊँचा मानते हैं और कुछ लोग लोग स्वयं को नीचा मानते हैं। इससे जाति प्रथा बढती है। और समाज में असमानता भी बढती है। यदि सबको अपनी-अपनी रूचि के अनुसार काम चुनने को अवसर मिलेगा तो उन्हें सबसे बराबर का सम्मान मिलेगा। ऐसा ही समाज सुखी और संतुष्ट होता है।

(ग) शारीरिक वंश-परंपरा और सामाजिक उत्तराधिकार की दृष्टि से मनुष्यों में असमानता संभावित रहने के बावजूद आंबेडकर समता’ को एक व्यवहार्य सिद्धांत मानने का आग्रह क्यों करते हैं? इसके पीछे उनके क्या तर्क हैं?
उत्तरः
शारीरिक वंश परंपरा और सामाजिक उत्तराधिकार की दृष्टि से मनुष्यों में असमानता संभावित रहने के बावजूद आंबेडकर समता को एक व्यवहार्य सिद्धांत मानने का आग्रह इसलिए करते हैं क्योंकि प्रत्येक व्यक्ति को अपनी क्षमता का विकास करने के लिए समान अवसर मिलने चाहिए। वे शारीरिक वंश परंपरा व सामाजिक उत्तराधिकार के आधार पर असमान व्यवहार को अनुचित मानते हैं। उनका मानना है कि समाज को यदि अपने सदस्यों से अधिकतम उपयोगिता प्राप्त करनी है तो उसे समाज के सदस्यों को आरंभ से ही समान अवसर व समान व्यवहार उपलब्ध करवाने चाहिए। राजनीतिज्ञों को भी सबके साथ समान व्यवहार करना चाहिए । समान व्यवहार और स्वतंत्रता का सिद्धांत ही समता का प्रतिरूप है। सामाजिक उत्थान के लिए समता का होना अनिवार्य हैं।

(घ) ‘ढोल में तो जैसे पहलवान की जान बसी थी। पहलवान की ढोलक पाठ के आधार पर सिद्ध कीजिए।
उत्तरः
लुट्टन सिंह जब जवानी के जोश में आकर चाँद सिंह नामक मंजे हुए पहलवान को ललकार बैठा तो सारा जनसमूह, राजा और पहलवानों का समूह आदि की यह धारणा थी कि यह कच्चा किशोर जिसने कुश्ती कभी सीखी नहीं है, पहले दाँव में ही देर हो जाएगा। हालाँकि लुट्टन सिंह की नसों में बिजली और मन में जीत का जज्बा उबाल खा रहा था। उसे किसी की परवाह न थी। हाँ, ढोल की थाप में उसे एक एक दाँव पेंच का मार्गदर्शन जरूर मिल रहा था। उसी थाप का अनुसरण करते हुए उसने ‘शेर के बच्चे को खूब धोया, उठा-उठाकर पटका और हरा दिया। इस जीत में एकमात्र ढोल ही उसके साथ था। अतः जीतकर वह सबसे पहले ढोल के पास दौड़ा और उसे प्रणाम किया।

प्रश्न 7.
निम्नलिखित प्रश्नों के उत्तर दीजिए। (3 + 2 = 5)
(क) सिंधु घाटी की सभ्यता कैसी थी? तर्क सहित उत्तर दें।
अथवा
19 मार्च, 1943 की चिट्ठी में ऐन ने गिल्डर मुद्रा के बारे में क्या बताया है? इससे क्या परेशानी आ गई थी?
उत्तरः
लेखक के मतानुसार सिंधु घाटी की सभ्यता ‘लो-प्रोफाइल’ सभ्यता थी। दूसरे स्थानों पर खुदाई करने से राजतंत्र को प्रदर्शित करने वाले महल धर्म की ताकत दिखाने वाले पूजा स्थल, मूर्तियाँ और पिरामिड मिले हैं जबकि मुअनजोदड़ो की खुदाई के दौरान न तो राजप्रसाद ही मिले और न ही मंदिर। यहाँ किसी राजा अथवा महंत की समाधि भी मिली। यहाँ जो नरेश की मूर्ति मिली है उनके मुकुट का आकार बहुत छोटा है। इतना छोटा कि इससे छोटे सिरपंत्र की कल्पना भी नहीं की जा सकती। इन लोगों की नावों का आकार भी ज्यादा बड़ा नहीं था। इन आधारों पर कहा जा सकता है कि सिंधु घाटी की सभ्यता आडंबरहीन सभ्यता थी। ऐसी सभ्यता जो छोटी होते हुए भी महान थी। जो विश्व की प्राचीनतम संस्कृति थी।

अथवा

ऐन बताती है कि हज़ार गिल्डर के नोट अवैध मुद्रा घोषित किए जा रहे हैं। यह ब्लैक मार्केट का धंधा करने वालों और उन जैसे लोगों के लिए बहुत बड़ा झटका होगा। उससे बड़ा संकट उन लोगों का है जो या तो भूमिगत हैं या जो अपने धन का हिसाब-किताब नहीं दे सकते । हज़ार गिल्डर का नोट बदलवाने के लिए आप इस स्थिति में हों कि ये नोट आपके पास आया कैसे और उसका सुबूत भी देना होगा। इन्हें कर अदा करने के लिए उपयोग में लाया जा सकता है; लेकिन अगले हफ्ते तक ही। पाँच सौ गिल्डर के नोट भी तभी बेकार हो जाएँगे। गिएड एंड कंपनी के पास अभी हजार गिल्डर के कुछ नोट बाकी थे जिनका कोई हिसाब-किताब नहीं था। इन्हें कंपनी ने आगमी वर्षों के लिए अनुमानित कर अदायगी में निपटा दिया है।

(ख) ‘अतीत में दबे पाँव’ पाठ के आधार पर शीर्षक की सार्थकता सिद्ध कीजिए।
अथवा
ऐन को यह डायरी लिखने की जरूरत क्यों महसूस हुई? इस डायरी के द्वारा वह क्या कहना चाहती है?
उत्तरः
इस पाठ में लेखक ने मुअनजोदड़ो की यात्रा के समय के अपने अनुभवों के विषय में बताया है। लेखक यहाँ पर पहुँचकर पुराने सुनियोजित शहर की एक-एक चीज का सिलसिलेवार परिचय करवाता है। वह उस सभ्यता के अतीत में झाँककर वहाँ के निवासियों और क्रियाकलापों को अनुभव करता है। यहाँ की सड़कें, नालियाँ, स्तूप, स्नानागार, सभागार, अन्न भंडार, कुएँ, आदि के अलावा मकानों की सुव्यवस्था को देखकर लेखक महसूस करता है कि लोग अब भी वहाँ मौजूद हैं। उसे बैलगाड़ियों की ध्वनि सुनाई देती हैं। रसोई घर की खिड़की से झाँकने पर वहाँ पक रहे भोजन की गंध आती है। लेखक कल्पना करता है कि यदि यह सभ्यता नष्ट न हुई होती तो आज भारत महाशक्ति बन चुका होता। यह शीर्षक उपयुक्त है।

अथवा

ऐन चाहती थी कि लोग नाजियों के अत्याचारों के बारे में विस्तार से जानें। कही हुई या सुनी हुई बातों का प्रभाव ज्यादा नहीं पड़ता। यह प्रभाव स्थायी भी नहीं होता। इसलिए उसने इन बातों को लिखने का मन बनाया ताकि लोग पढ़े सच को जानें और उससे प्रभावित हों। वह लिखती है कि मैं सही बता रही हूँ कि युद्ध के दस साल बाद लोग इससे कितना चकित होंगे जब उन्हें पता चलेगा कि यहूदियों को अज्ञातवास में क्यों जाना पड़ा? यहूदियों पर कितने जुल्म हुए? ये सब बातें बताने के लिए ही ऐन ने डायरी लिखी।

Students can access the CBSE Sample Papers for Class 12 Geography with Solutions and marking scheme Term 2 Set 8 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Geography Term 2 Set 8 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 35
Roll No. ___________

General Instructions:

• Question paper is divided into 5 sections A, B, C, D & E
• In section A, question number 1 to 3 are Very Short Answer type questions. Attempt any 3 questions.
• In section B, question number 4 is Source based question.
• In section C, question number 5 & 6 are Short Answer type questions.
• In section D, question number 7 to 9 are Long Answer type questions.
• In section E, question number 10 is a Map based question.

Section – A
Very Short Answer Questions

Question 1.
Describe the highways of any one developed region of the world. (2)
Answer:
In developed countries, every city and port town is linked through highways. For example, in North America, highway density is high, about 0.65 km per sq km. Every place is within 20 km distance from a highway. Cities located on the Pacific coast (west) are well-connected with those of the Atlantic Coast (East). Likewise, the cities of Canada in the north are linked with those of Mexico in the South.

Question 2.
Define transport (2)
Or
Explain the dependence of transportation on distance and volume of passenger or cargo by giving examples.
Answer:
Transport is a service or facility for the carriage of persons and goods from one place to the other using humans, animals and different kinds of vehicles. Such movements take place over land, water and air. Roads and railways form part of land transport; while shipping and waterways and airways are the other two modes. Transportation depends on distance and volume of passenger or cargo. For example,

• Road transport is cheaper and faster over short distances and for door-todoor services.
• Railways are most suited for large volumes of bulky materials over long distances within a country.

Question 3.
State the objective and activities of NITI Aayog. (2)
Answer:
NITI Aayog has been set up with the objective of involving the states in economic policy making for India for providing strategic and technical advice to the Central and State governments. Its entire activities can be categorised as

• Policy and programme framework.
• Cooperative federalism
• Monitoring and evaluation
• Think tank and knowledge hub

Section – B
Source Based Question

Question 4.
Read the source given below and answer the following questions by choosing the correct options.
The pressure on agricultural land increases not only due to the limited availability but also by deterioration of quality of agricultural land. Soil erosion, waterlogging, salinisation and alkalinisation of land lead to land degradation. What happens if land is consistently used without managing its fertility? Land is degraded and productivity declines.

Land degradation is generally understood either as a temporary or a permanent decline in productive capacity of the land. Though all degraded land may not be wasteland, but unchecked process of degradation may lead to the conversion to wasteland. There are two processes that induce land degradation. These are natural and created by human beings.

National Remote Sensing Centre (NRSC) has classified wastelands by using remote sensing techniques and it is possible to categorise these wastelands according to the processes that have created them. There are a few types of wastelands such as gullied /ravinous land, desertic or coastal sands, barren rocky areas, steep sloping land, and glacial areas, which are primarily caused by natural agents.

There are other types of degraded lands such as waterlogged and marshy areas, land affected by salinity and alkalinity and land with or without scrub, which have largely been caused by natural as well as human factors. There are some other types of wastelands such as degraded shifting cultivation area, degraded land under plantation crops, degraded forests, degraded pastures, and mining and industrial wastelands are caused by human action.

i. What is the result of unregulated use of agricultural land? (1)
Answer:
Unregulated use of agricultural can result in increase in soil moisture and fertility.

ii. Land degradation can be temporary or permanent. What is the possible reason behind a permanent land degradation? (1)
Answer:
The possible reason behind a permanent land degradation could be ignorance of sign of degradation and no efforts to restore the land.

iii. Lands under shifting cultivation or selective plantation may degrade due to which factor? (1)
Answer:
Lands under shifting cultivation or selective plantation may degrade due to loss of soil fertility and moisture.

Section – C
Short Answer Questions

Question 5.
Explain how access to transportation and communication facilities affect the location of industries especially in the context of footloose industries. (3)
Or
Identify the reason behind the resulting of a ‘New-Ruhr’ landscape. Explain this ‘New-Ruhr’ landscape.
Answer:
Access to transportation and communication facilities greatly affect the location of industries. Modem industry is inseparably tied to transportation systems. Improvements in transportation led to integrated economic development and regional specialisation of manufacturing. The cost of transport and location of industries depends on speedy and efficient transport facilities to carry raw materials to the factory and to move finished goods to the market.

In this context, footloose industries can be located in a wide variety of places. The important factor in their location is accessibility by road network. They are not dependent on any specific raw material, weight losing or otherwise. They largely depend on component parts which can be obtained anywhere. They produce in small quantity and also employ a small labour force. These are generally not polluting industries.
Or
‘New-Ruhr’ landscape refers to the change in industrial and other economic activities in the Ruhr coal field region in Germany. The reason behind it is changing demands and structure in coal and steel industries. The Ruhr coal field in Germany has been one of the major industrial regions of Europe. Coal and iron and steel formed the basis of the economy, but as the demand for coal declined, the industry started shrinking.

Once the iron ore exhausted, the industry confirmed on imported ore. The Ruhr region is responsible for 80 per cent of Germany’s total steel production. However, changes in the industrial structure have led to the decay of some areas, and problems of industrial waste and pollution. The future prosperity of the Ruhr is based less on the products of coal and steel and more on the new industries like the huge Opel car assembly plant, new chemical plants, universities. Outof-town shopping centres have appeared resulting in a ‘New Ruhr’ landscape.

Question 6.
Differentiate between the distribution of mineral resources in the North Eastern Plateau region and South Western Plateau region of India. (3)
Answer:
Differences between the distribution of mineral resources in North Eastern Plateau region and South Western Plateau region are North Eastern Plateau Region This belt covers Chota Nagpur (Jharkhand), Odisha Plateau, West Bengal and parts of Chhattisgarh Major iron and steel industries are located in this region It has variety of minerals viz. iron ore coal, manganese, bauxite, mica.

The South-Western Plateau Region This belt extends over Karnataka, Goa and contiguous Tamil Nadu uplands and Kerala. This belt is rich in ferrous metals and bauxite. It also contains high grade iron ore, manganese and limestone. This belt packs in coal deposits except Neyveli lignite. This belt does not have as diversified mineral deposits as the North-Eastern belt. Kerala has deposits of monazite and thorium, bauxite clay. Goa has iron ore deposits.

Section – D
Long Answer Questions

Question 7.
Iron and steel industry are basic industry which are important for development of an economy. State its global distribution with details on major iron and steel producing countries.(5)
Or
Technology has revolutionised the global economies with faster and efficient production in all types of industries. Discuss the concept of ‘High technology industries’.
Answer:
The iron and steel industry is one of the most complex and capital-intensive industries and is largely concentrated in the advanced countries of North America, Europe and Asia. In 1970’s, Japan, USA and western Europe were accounting for 2/3rd global production of iron and steel. However, the developing nations such as China, India, Brazil and South Korea gradually became important steel producers. The global distribution of iron and steel industry is

In USA, most of the production comes from the north Appalachian region (Pittsburgh), Great Lake region (Chicago-Gary, Erie, Cleveland, Lorain, Buffalo and Duluth) and the Atlantic Coast (Sparrows Point and Morisville). The industry has also moved towards the southern state of Alabama. In Europe, U.K, Germany, France, Belgium, Luxembourgh, the Netherlands and Russia are the leading producers.

The important steel centres are Scun Thorpe, Port Talbot, Birmingham and Sheffield in the U.K.; Duisburg, Dortmund, Dusseldorf and Essen in Germany, Le Creusot and St. Ettienne in France, and Moscow, St. Petersburgh, Lipetsk, Tula, in Russia and Krivoi Rog, and Donetsk in Ukraine.

In Asia, the important centres include Nagasaki and Tokyo-Yokohama in Japan; Shanghai, Tienstin and Wuhan in China; and Jamshedpur, Kulti-Burnpur, Durgapur, Rourkela, Bhilai, Bokaro, Salem, Visakhapatnam and Bhadravati in India.
Or
High-tech industries refer to those industries where the major work force has technology based occupations, such as engineers and scientists. High technology, or simply high-tech, is the latest generation of manufacturing activities. Some of the key features of high-tech industries are

In these industries, application of intensive Research and Development (R and D) efforts leads to the manufacturing of products of an advanced scientific and engineering character. Professional (white collar) workers make up a large share of the total workforce. These highly skilled specialists greatly outnumber the actual production (blue collar) workers.

Robotics on the assembly line, Computer – aided Design (CAD) and manufacturing, electronic controls of smelting and refining processes, and the constant development of new chemical and pharmaceutical products are notable examples of a high-tech industry.

Neatly spaced, low, modern, dispersed, office-plant-lab buildings rather than massive assembly structures, factories and storage areas mark the high-tech industrial landscape. Planned business parks for high-tech start-ups have become part of regional and local development schemes. High-tech industries which are regionally concentrated, self-sustained and highly specialised are called technopolies. The Silicon Valley near San Francisco and Silicon Forest near Seattle are examples of technopolies.

Question 8.
Movement of people and goods is critical for economy. What is the role of land transport in Indian economy? (5)
Answer:
Land transport via pathways and unmetalled roads have been used for transportation in India since ancient times. Land transport is usually defined in two broad categories i.e. road transport and rail transport. The importance of land transport in Indian economy is

Road Transport India has one of the second largest road networks in the world. About 85 per cent of passenger and 70 per cent of freight traffic are carried by roads every year. Road transport is relatively suitable for connectivity and shorter distance travel. For the purpose of construction and maintenance, roads are classified as National Highways (NH), State Highways (SH), Major District Roads and Rural Roads.

Rail Transport Indian Railways network is one of the longest in the world and largest in Asia. It facilitates the movement of both freight and passengers by approx 11000 trains daily and contributes to the growth of the economy. Railways transport over 5 billion passengers and 350 million tones cargo annually. Indian Railways is the largest government undertaking in the country. Due to its very large size and consequent pressure on the centralised railway management system, the railway system in India has been divided into 16 zones.

Question 9.
Discuss the importance and distribution of waterways as form of water transport in India. (5)
Answer:
Waterways is an important mode of water transport for both passenger and cargo traffic in India in
the following ways

• It is the cheapest means of transport and is most suitable for carrying heavy and bulky material,
• It is a fuel-efficient and eco-friendly mode of transport. Water offers less resistance during movement in comparison to the land transport, and hence is fuel and cost effective.

Generally, there is no need to lay down new routes for water transport due to pre-existing river channels and water bodies, which further saves resources. The types of water transport with their distribution are

(i) Inland Waterways India has 14,500 km of navigable waterways, contributing about 1% to the country’s transportation. It comprises rivers, canals, backwaters, creeks, etc. There are a total of five national water ways in India, i.e.

• NW1 Allahabad-Haldia stretch, 1620 km.
• NW2 Sadiya-Dhubri stretch, 891 km
• NW3 Kottapuram-Kollam stretch, 205 km.
• NW4 Specified stretches of Godavari and Krishna rivers along with Kakinada Puducherry stretch of canals, 1078 km.
• NWS Specified stretches of river Brahmani along with Matai river, delta channels of Mahanadi and Brahmani rivers and East Coast canals, 588 km.

(ii) Oceanic Routes India has a vast coastline of approximate 7,517 km, including islands. Twelve major and 185 minor ports provide infrastructural support to these route Few examples of major ports are Kolkata, Mumbai, Chennai, Cochin, Paradip and Nhavasheva (LN Port). Majority of Indian ports are located along the Peninsular coast line of India. For example, in States of Tamil Nadu, Kerala, Kamataka, Odisha, etc.

Section – E
Map Based Question

Question 10.
On the political map of the world, identify the following features (Attempt any 5). (1 × 5 = 5)
A. An airport in Africa
B. A major sea port
C. A major airport
D. A seaport in south America
E. A major seaport in Australia
F. A major seaport in China
Answer:

Students can access the CBSE Sample Papers for Class 12 Economics with Solutions and marking scheme Term 2 Set 6 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Economics Term 2 Set 6 with Solutions

Time allowed: 2 Hours
Maximum Marks: 40

General Instructions:

• This is a Subjective Question Paper containing 13 questions.
• This paper contains 5 questions of 2 marks each, 5 questions of 3 marks each and 3 questions of 5 marks each.
• 2 marks questions are Short Answer Type Questions and are to be answered in 30-50 words.
• 3 marks questions are Short Answer Type Questions and are to be answered in 50-80 words.
• 5 marks questions are Long Answer Type Questions and are to be answered in 80-120 words.
• This question paper contains Case/Source Based Questions.

Question 1.
Distinguish between autonomous investment and induced investment.
OR
Distinguish between ex-ante investment and ex-post investment. (2)
Answer:
Autonomous investment refers to the investment which is independent of the level of income in the economy, whereas, induced investment changes as the rate of interest or level of income changes in the economy.

OR
Ex-ante investment is the desired or planned investment corresponding to different income levels in the economy whereas, ex-post investment is the actual investment in the economy during the period of one year.

Question 2.
From the following data, calculate:
(A) Consumption Expenditure and
(B) Investment Expenditure for the economy.

Particulars	Amount (in ₹)
The equilibrium level of income	5,000
Autonomous consumption	500
Marginal Propensity to Save	0.4

OR

If in an economy:
Change in initial Investments (Δl) = ₹500 crore
Marginal Propensity to Save (MPS) = 0.2

Find the values of the following:
(A) Investment multiplier (k)
(B) Change in final income (ΔY) (2)
Answer:
(A) We know that:
Consumption expenditure = C + bY
= 500 + 0.6 (5,000)
= ₹ 3,500 crore

(B) Also, at equilibrium level,
Y = C + 1
5,000 = 3,500 + l
l = 1,500 crore
OR
(A) K = 1/MPS
K = 1/0.2 = 5
(B) ΔY = K(ΔI)
ΔY = 5 x 500
= ₹ 2,500 crore

Question 3.
Are the following workers a beggar, a thief, a smuggler, a gambler? Why? (2)
Answer:
All those who are engaged in economic activities, in whatever capacity — high or low, are workers. Thus, they are not workers, as they are not engaged in any economic activity.

Question 4.
“India has emerged as a hotspot for medical tourism”. Defend the statement with valid arguments. (2)
Answer:
The given statement is defended as in the recent past India has witnessed many foreign nationals visiting for surgeries, organ transplant, dental and even cosmetic care. The prime reason for this phenomenon can be quoted as:

1. Health services in India offer latest medical technologies with qualified professionals.
2. All these medical services are less costly in India as compared to similar health care services in other countries.

Question 5.
Why is self-employed workforce higher in rural areas?
OR
Compare and analyze the distribution of working persons in different industries during the year 2017-18 on the basis of ‘gender or sex’. (2)
Answer:
Most of the rural people are mainly engaged in agriculture and do farming on their own plots thus, self-employed workforce higher in rural areas.
OR
Though both men and women workers are concentrated in the primary sector, women workers’ concentration is very high there. About 57 percent of the female workforce is employed in the primary sector whereas less than half of males work in that sector. Men get opportunities in both secondary and service sectors.

Question 6.
Which of the following items will be included/not included while estimating Gross Domestic Product? Give valid reasons in support of your answer.
(A) Wages received by an Indian working in the British Embassy in India
(B) Financial aids received from abroad after “Fani cyclone”
(C) Purchase of second-hand machinery from abroad. (3)
OR
If GDP_FC = ₹ 24,760, operating surplus = ₹ 13,450, mixed-income = ₹ 4,260 and consumption of fixed capital = ₹ 530, then what will be the value of compensation of employees? (3)
Answer:
(A) Wages received by an Indian working in British embassy in India is not a part of economic territory of India, as British Embassy is a part of Economic territory of Britain.

(B) Financial aid is a transfer income as no factor service is provided in return. Hence, it is not included while estimating the value of GDP.

(C) Purchase of second hand machinery from abroad is not included as the value of imports are deducted while estimation GDP of a country.
OR
GDP_FC = Operating Surplus + Mixed Income + Consumption of Fixed Capital + Compensation of Employees 24,760 = 13,450 + 4,260 + 530 + Compensation of Employees Compensation of Employees = 24,750 – 13,450 – 4,260 – 530 = ₹6,520

Question 7.
Give reasons for the slow growth and re-emergence of poverty in Pakistan. (3)
Read the following case carefully and answer question number 8 and 9 given below:

Some economists have projected that India will become the third biggest economy in the world a few decades from now. For that to happen, India will have to boost its infrastructure investment. In any country, as the income rises, the composition of infrastructure requirements changes significantly.

For low-income countries, basic infrastructure services like irrigation, transport and power are more important. As economies mature and most of their basic consumption demands are met, the share of agriculture in the economy shrinks and more service-related infrastructure is required. This is why the share of power and telecommunication infrastructure is greater in high-income countries.

Thus, development of infrastructure and economic development go hand in hand. Agriculture depends, to a considerable extent, on the adequate expansion and development of irrigation facilities. Industrial progress depends on the development of power and electricity generation, transport and communications. Obviously, if proper attention is not paid to the development of infrastructure, it is likely to act as a severe constraint on economic development.
Answer:
The reasons for the slowdown of growth and re-emergence of poverty in Pakistan’s economy are agricultural growth and food supply situation were based not on an institutionalized process of technical change but on good harvest. When there was a good harvest, the economy was in good condition, when it was not, the economic indicators showed stagnation or negative trends.

Question 8.
“Some economists have projected that India will become the third biggest economy in the world a few decades from now. For that to happen, India will have to boost its infrastructure investment.” Explain the importance of infrastructure in the light of this statement. (3)
Answer:
Infrastructure is critical to rapid economic growth and poverty eradication in the country. Adequate infrastructure in the form of a road and rail transport system, ports, power, airports and their efficiency are also needed to integrate the Indian economy and other world economies. The expansion in infrastructure facilities such as irrigation, rural electrification, roads and road transport will promote agricultural growth and setting up of agro-processing industries.

Question 9.
“The share of power and telecommunication infrastructure is greater in high-income countries.” Why? (3)
Answer:
In any country, as the income rises, the composition of infrastructure requirements changes significantly. For low-income countries, basic infrastructure services Like irrigation, transport and power are more important. As economies mature and most of their basic consumption demands are met, the share of agriculture in the economy shrinks and more service-related infrastructure is required. This is why the share of power and telecommunication infrastructure is greater in high-income countries.

Question 10.
Compare and analyse the given data of India and China with valid reasons:

Country	Annual growth rate of population (2015)	Sex ratio (per thousand males)
India	1.2%	929
China	0.5%	941

Answer:
(A) The given data shows that China could arrest its annual population growth rate with the implementation of some stringent measures in late 1970’s like the introduction of one child norm. This step has been instrumental in controlling the growth of population in China. India stands virtually more than double to China at its annual population growth rate of 1.2% as compared to China’s annual population growth rate of 0.5% pa.

(B) The social dynamics of both the countries are similar to each other; sex ratio is low and biased in both the countries due to preference for male child. Whereas, India stands at 929 females per 1000 males, China is not far ahead at 941 females per 1000 males.

Question 11.
(A) “Gross Domestic Product (GDP) does not give us a clear indication of economic welfare of a country.” Defend or refute the given statement with valid reason.

(B) If in a locality, a new park is developed by the municipal corporation, it will have externalities, both positive and negative. State one example for each of both types of externalities with reason. (5)
Answer:
(A) Yes, given statement is defended. As GDP may not take into account

• Non-monetary exchanges like services of housewife
• Externalities i.e. benefits and harms which are caused due to economic activities
• Distribution of income.

(B) The park in neighborhood can be a source of positive externality as it helps in reducing pollution and thereby improving health and efficiency.

The park in a neighborhood can be a source of negative externality if it is used by anti-social elements. This can increase crime and lead to insecurity.

Question 12.
(A) Calculate national income from the following data: (₹ in crores)
(i) Private final consumption expenditure 900
(ii) Profit 100
(iii) Government final consumption expenditure 400
(iv) Net indirect taxes 100 M Gross domestic capital formation 250
(Vi) Change in stock 50
(vii) Net factor income from abroad (-)40
(viii) Consumption of fixed capital 20
(ix) Net imports 30

(B) Describe the expenditure method of calculating Gross Domestic Product at Market Price. (5)
OR
(A) Describe incomes from property and entrepreneurship.
(B) Calculate Gross Value Added at Market price (GVA_MP) from the following data: (5)

Particulars	Amount (in ₹ lakh)
Depreciation	20
Domestic Sales	200
Change in Stocks	(-) 10
Exports	10
Single-use producer oods	120
Net Indirect Taxes	20

Answer:
(A) National Income = Private final consumption expenditure + Government final consumption expenditure + Gross domestic capital formation – Consumption of fixed capital – Net imports – Net indirect taxes + Net factor income from abroad = 900 + 400 + 250 – 20 – 30 – 100 + (-)40 = ₹1,360 crore

(B) To calculate GDPMP by the expenditure method, we add up final expenditures on the goods and services produced by all the economic sectors of an economy. Expenditures incurred on consumption and investment are final expenditures.

These are classified into:
(i) Private final consumption expenditure.
(ii) Government final consumption expenditure.
(iii) Gross domestic capital formation.
(iv) Net exports = Exports less Imports

The sum total of these expenditures is GDP_MP.
OR
(A) Incomes from property and entrepreneurship are incomes earned by property owners. It includes, rent and royalty, profit, interest. It can also be termed as Operating Surplus.

(B) GVAMP = [(ii)+(iii)+(iv)]-(v)
= [200 + (-)10 + 10] – 120
= 200 – 120
= ₹80 lakhs

Question 13.
Explain the determination of equilibrium level of national income using ‘saving and investment’ approach. Use diagram. Also explain the effects if saving is greater than investment. (5)
Answer:
The equilibrium is where S = l
i.e. at E, where the savings curve ‘S’ and investment curve ‘l’ intersect.

If S > I, it means AD < AS. This leads to unplanned inventories.

Producers reduce output till S = I again.

Students can access the CBSE Sample Papers for Class 12 Biology with Solutions and marking scheme Term 2 Set 12 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Biology Standard Term 2 Set 12 for Practice

Time Allowed: 2 Hours
Maximum Marks: 40

General Instructions:

• All questions are compulsory.
• The question paper has three sections and 13 questions. All questions are compulsory.
• Section-A has 6 questions of 2 marks each; Section-B has 6 questions of 3 marks each; and Section-C has a case-based question of 5 marks.
• There is no overall choice. However, internal choices have been provided in some questions. A student has to attempt only one of the alternatives in such questions.
• Wherever necessary, neat and properly labeled diagrams should be drawn.

SECTION – A
(Section A has 6 Questions of 2 marks each.)

Question 1.
(A) Name the property of normal cells, the absence of which in cancerous cells leads to the formation of tumours.
(B) The tumors are classified into two types, in which one of the types remains confined to the original location and the other type of tumours invade neighboring tissues. Name the two types of tumours. (2)

Question 2.
(A) Given below is the picture of the plant Rauwolfia vomitoria. Genetic variation is very important in this plant. Why?

(B) A bird named Great Indian Bustard found in Rajasthan is a threatened species. What do you mean by threatened species?
OR
Rahul read an article that hunting and human population growth is major threats to the Bengal tigers. Due to these reasons, it has become an endangered species. What do you mean by endangered species? Give two examples. (2)

Question 3.
(A) Name the gases that are produced in anaerobic sludge digesters.
(B) Which enzyme is used as a clot-buster in patients who have undergone myocardial infarction, to remove clots from blood vessels? (2)

Question 4.
Some individuals experience sudden sneezing and wheezing after reaching a hill station, while these symptoms disappear when they return to the plains. What is such a response called? How does the body produce it? (2)

Question 5.
Egrets and grazing cattle are often seen together as depicted in the picture. What is this type of interaction called? Give a reason for such kind of association.

OR
Illustrate the relationship between biotic potential and environmental resistance. (2)

Question 6.
(A) Define Antibiotics.
(B) Which was the first antibiotic and who discovered it? (2)

SECTION – B
(Section B has 6 Questions of 3 marks each.)

Question 7.
(A) If one of the insect pollinators becomes extinct in an ecosystem. Would it affect the ecosystem? If yes, how?
(B) Seed banks are used to store seeds of different genetic strains. Briefly describe the conservative strategy involved in this.
(C) From the study of the fossil records, it was found that mass extinction of species happened earlier, even before humans appeared. What could have triggered mass extinctions of species in the past? (3)

Question 8.
(A) Why malaria is restricted to the tropics?
(B) Explain why tetanus antitoxin is given to a person injured in an accident with a bleeding wound and not a tetanus vaccine? (3)

Question 9.
Explain briefly how desert ephemeral plants are adapted to withstand hot and dry environments?
OR
(A) How would you classify organisms on the basis of their tolerance to salinity?
(B) Certain animals like fungi, zooplankton and bears have the ability to cope up with the temporary short-lived stressful environmental conditions. How do they do it? (3)

Question 10.
(A) Reema (who works in a genetic engineering firm) was making her friend understand that manipulation of living organisms by the human race is not ethical and should be regulated. Is it true? Why? Name the set of standards which are used to regulate human activities in relation to biological world.
(B) A human protein a-1 antitrypsin is produced in a transgenic animal created by the introduction of the gene which codes for it. For what purpose this protein is used? (3)

Question 11.
(A) In most of the genetic engineering experiments, mice are used as the preferred organism for transgenic production. Why?
(B) RNA interference involves the silencing of specific mRNA that helps to prevent many parasitic infestations. How? (3)

Question 12.
(A) What are the different places where methanogens are found?
(B) How do methanogens help in producing biogas? (3)

SECTION – C
(Section C has a case-based question of 5 marks.)

Question 13.
During o visit to a genetic engineering laboratory, students saw a PCR machine as shown in the picture. The students were amazed os their teacher told them, this small machine can make miLlions of copies of DNA from a very small sample of blood, hair, etc, and that too within few hours. Based on this answer the following questions:

(A) Who deveLoped the technique of PCR?
(B) What ¡s the basis of the technique of PCR?
(C) What ¡s the source of Tag Potymerose enzyme used in PCR?
(D) Name the finaL step of PCR and explain it briefly.

OR
The following picture shows different types of bioreactors that are used in downstream processing.
Based on the below picture answer the following questions:

(A)
(i) Why mechanical agitation is required in stirred tank bioreactors and not in air-lift reactors?
(ii) What do you mean by continuous culture? List one of its advantages.
(B) List any two advantages of stirred tank bioreactors over shake flasks. (5)

Students can access the CBSE Sample Papers for Class 12 Biology with Solutions and marking scheme Term 2 Set 2 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Biology Standard Term 2 Set 2 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 40

General Instructions:

• All questions are compulsory.
• The question paper has three sections and 13 questions. All questions are compulsory.
• Section-A has 6 questions of 2 marks each; Section-B has 6 questions of 3 marks each; and Section-C has a case-based question of 5 marks.
• There is no overall choice. However, internal choices have been provided in some questions. A student has to attempt only one of the alternatives in such questions.
• Wherever necessary, neat and properly labeled diagrams should be drawn.

SECTION – A
(Section A has 6 Questions of 2 marks each.)

Question 1.
Give reasons for the following:
(A) An inoculum of curd is added to milk for curdling it.
(B) Dough has a puffed-up appearance.
OR
Why it is considered beneficial to construct a biogas plant in rural areas? (2)
Answer:
(A) The inoculum contains millions of Lactic acid bacteria (LAB) or Lactobacilli which have the ability to convert the lactose sugar present in the milk into lactic acid. This lactic acid results in coagulation and digestion of milk protein casein. Therefore, the milk changes into curd.

(B) The dough has a puffed-up appearance due to the production of CO₂ gas which is produced through the process of fermentation by bacteria.
OR
Cattle dung serves as the raw material for the biogas plant and it is available in plenty amount in rural areas. In agriculture, the spent slurry from the biogas plant is used as a manure. Also, the biogas is used for lighting and cooking in rural areas as distribution is only in short distances. Therefore, it is beneficial to construct a biogas plant in rural areas.

Question 2.
The diagram given below shows the formation of a tumour in between the normal cells. The cancer cells divide uncontrollably. Name the process in which the cells from these tumours migrate through blood or lymph to other parts of the body, and wherever they get lodged in the body, they result in the development of a new tumour. Which kind of tumour is shown this process? (2)

Answer:
The process in which the cells of the tumours migrate through blood or lymph to other parts of the body, and wherever they get lodged in the body, they result in the development of a new tumour is called as Metastasis.
The process of Metastasis is shown by malignant tumours.

Question 3.
In the diagram given below, a bacterial cell is shown. Write the name of the part labeled as part ‘A’ and ‘B’. Also mention the use of part ‘A’ in rDNA technology. (2)

Answer:
The name of the part labeled as part ‘A’ and ‘B’ is:
A – PLasmid,
B – Nucleoid
In rDNA technology, plasmid is used as a cloning vector to transfer the gene of interest into the host cell.

Question 4.
(A) Ramesh explained Riya that ecology is defined as the branch of science that deals with the study of the interactions among organisms. Elaborate the definition to make her understand better.
(B) Due to global warming, Life of many organisms has changed and became difficult. Which among eurythermal or stenothermal organisms can cope up better during global warming? (2)
Answer:
(A) Ecology is the field that deals with the balance between development and maintenance of natural environment and biotic communities, use and conservation of resources, finding solutions of local, regional and global environmental problems.

(B) The organisms that can cope up better during global warming are Eurythermal organisms. These organisms have greater adaptability.

Related Theory
Eurythermal are the organisms that can tolerate and thrive in a wide range of temperatures. Examples: most mammals and birds. Stenothermal are the organisms that can tolerate a narrow range of temperatures. Example: amphibians.

Question 5.
(A) Roma was wondering about the diverse organisms present around her. She was excited by the fact that so many different types of plants and animals and even microorganisms are present around us. What is the term used for this? Define it.
(B) Within a species, how different sub¬species, variety, breeds and forms are created? illustrate with an example. (2)
Answer:
(A) The variety of life on earth at all its levels, from genes to ecosystems is referred to as biodiversity. Biodiversity can be simply defined as the number and variety of organisms found within a specified geographic region. It refers to the varieties of plants, animals and microorganisms, the genes they contain and the ecosystems they form.

(B) Different sub-species, variety, breeds, forms are formed due to genetic diversity within the species.
Example: The medicinal plant Rauwolfia vomitoria growing in different Himalayan ranges shows genetic variation in terms of the potency and concentration of the active chemical called reserpine that the plant produces.

Related Theory
Genetic diversity is defined as the measure of variety of genetic information contained within the species. Another example is: India has more than 50,000 genetically different strains of rice, and 1,000 varieties of mango.

Question 6.
(A) After the Covid-19 pandemic, government is stressing on vaccination campaign. What is it that prevents a person to suffer from a disease he/she is vaccinated against? Give one reason.
(B) It is advised to avoid crowded and closed places like cinema halls, etc, during What do you mean by withdrawal syndrome changing weather. Why? jn case of drug and alcohol abuse? (2)
Answer:
(A) The vaccine contains the dead pathogen that provokes the active immunity of an individual leading to the formation of antibodies that protect him/her from the disease.

Related Theory
Active Immunity: When an individual (host) is exposed to antigens in the form of living or dead microbes or other proteins. It results in the production of antibodies. This kind of immunity is slow and thus takes time to give its full effective response, but its effect is long lasting. It has no side effects.

An active immunity is induced in our body by deliberately injecting the microbes/antigens either through immunization/vaccination (termed as artificial immunity) or through natural infection by infectious organisms (termed as natural immunity).

(B) During changing weather, the germs or pathogens are more active and prevalent in the atmosphere as the conditions are suitable for their growth and these pathogens are more in crowded and closed places. Therefore, the chances of infection are high in such places.

Related Theory
Infectious agents are more active during changing weather as moist conditions favors the growth of pathogens. Also, at that time the body of the individual is adapting the changing environmental conditions of temperature, humidity, etc., so the person is more vulnerable to diseases and thus can easily get infected by these pathogens.
OR
Withdrawal syndrome is also known as discontinuation syndrome. This occurs in individuals who have developed physiological dependence on drugs or alcohol and who discontinue or reduce their use of it.

Related Theory
The person becomes addicted and dependent on drugs or alcohol in the absence of any guidance or counselling. The tendency of the body to manifest a characteristic and unpleasant withdrawal syndrome if regular dose of drugs/alcohol is abruptly discontinued is called as Dependence. The withdrawal symptoms include anxiety, shakiness, nausea and sweating that are relieved when use is resumed again. The withdrawal symptoms can be severe and even life threatening and the person may require medical supervision. The patient can break all social norms in order to get sufficient funds to satiate his/her needs due to dependence on drugs or alcohol. This can lead to many social adjustment problems.

SECTION – B
(Section B has 6 Question of 3 marks each.)

Question 7.
(A) Suhani and her friends went for
educating their colony regarding the spread of diseases via mosquitoes. They emptied all the overhead tanks, which were not in use for last few months. What was the purpose of this act? Name the pathogen which is responsible for causing malaria (mosquito borne disease).

(B) The thymus gland of a person is removed. Will the immune system of that person be affected? If yes, how? (3)
Answer:
(A) The purpose behind emptying the overhead tanks was to prevent mosquito borne diseases as the water in the tanks was stagnant and can become a breeding ground for the mosquitoes. The pathogen which is responsible for causing malaria is Plasmodium (a protozoan).

(B) Thymus gLand is a primary lymphoid organ where immature lymphocytes differentiate into antigen-sensitive lymphocytes. Therefore, removal of thymus gland makes the immune system weak and as a result the person’s body becomes more prone to infectious diseases.

Question 8.
The following picture shows the three basic steps of genetic engineering. Write down these steps briefly.

OR
One of the crucial steps of genetic engineering is the identification of recombinant DNA containing the desired gene. This is done by a process called insertional inactivation. Explain this process with the help of an example. (3)
Answer:
The three basic steps of genetic engineering or making a Genetically Modified Organism(GMO) are:
(i) Identification of DNA with desirable genes.
(ii) Introduction of the identified DNA into the suitable host to form recombinant DNA (rDNA).
(iii) Maintenance of introduced DNA in the host and transfer of the DNA to its progeny.
OR
Insertional inactivation refers to the insertion of a certain gene in the host DNA at a particular site. Due to this insertion, the function of the gene at whose site insertion has taken place gets inactivated. This process is used to identify recombinant DNA containing organisms from those who are non-recombinants.

Example: A recombinant DNA is inserted within the coding sequence of an enzyme, (3-galactosidase, that results into inactivation of the gene for synthesis of this enzyme. This is known as insertional inactivation. If the plasmid in the bacteria is devoid of the insert (foreign DNA), it will result in the formation of blue-coloured colonies due to the presence of a chromogenic substrate. Whereas the presence of insert results into insertional inactivation of
the β-galactosidase gene and thus it does not code for the enzyme, hence the chromogenic substrate is not acted upon by the enzyme, thus the colonies do not produce any coLour and are identified as recombinant coLonies.

Question 9.
(A) A 4-year-old girl undergone the first gene
therapy in 1990 as shown in the picture below. For which disease she was treated and name the scientists responsible for attempting this successful therapy?

(B) RNA interference is a method of cellular defense in which silencing of a specific mRNA is performed through a complementary RNA molecule that binds to and prevents translation of the mRNA. From where does this complementary RNA come from? (3)
Answer:
(A) In 1990, the first clinical gene therapy was given to a 4-year-old girl suffering from Adenosine Deaminase (ADA) deficiency by Michael Blease and W. French Andreson of National Institute of Health.

Related Theory
The enzyme adenosine deaminase is very important for the immune system to function. The cause of the disorder is deletion of the gene coding for adenosine deaminase.
(B) This complementary RNA can come from:
(i) An infection by viruses having RNA genomes.
(ii) Mobile genetic elements (transposons) that replicate via an RNA intermediate.

Question 10.
(A) The given picture shows the antigen- antibody reaction. Name a technique based on the principle of antigen- antibody reaction used in the detection of a virus.

(B) It was an amazing discovery in the field of biotechnology that bacterium Bacillus thuringiensis produces a toxin that can kill insects belonging to a particular group. But the bacteria itself do not get killed by the toxin it produces. Explain the major reason behind this? (3)
Answer:
(A) The technique that is based on the principle of antigen-antibody interaction and used in the detection of a virus is Enzyme-Linked Immunosorbent Assay (ELISA).

Related Theory
Antigen-antibody interaction refers to a specific chemical interaction between antibodies produced by B-lymphocytes and antigens from any source during an immune reaction. Antibodies recognize specific proteins present on antigen surface. The reaction between antigen and antibody leads to agglutination. ELISA can be used to detect an antibody to HIV.

(B) Bacillus thuringiensis forms protein crystals during a particular phase of their growth. A toxic insecticidal protein is present in these crystals. But the bacterium itself is not affected or killed by this toxin because the BT toxin protein exist as inactive protoxins, but when an insect feed on such a plant and ingest the inactive toxin, the protoxin gets converted into an active form due to the alkaline pH of the gut, that solubilize the crystals. The activated toxin binds to the surface of midgut epithelial cells and make it porous resulting in cell swelling and lysis and finally cause death of the insect.

Question 11.
(A) Parasites are well adapted to survive inside the body of their respective hosts. Enlist any two adaptive features evolved in parasites that enable them to survive successfully in or on their hosts.
(B) Among all the abiotic factors that influences life of organisms, why temperature is considered to be the most relevant factor? (3)
Answer:
(A) Parasites have evolved special adaptations that enable them to survive successfully, in or on their hosts they are:

• Loss of unnecessary sense organs.
• Presence of adhesive organs or suckers to cling on to the host.
• Loss of digestive system.
• High reproductive capacity. (Any two)

(B) Temperature is an important ecologically
environmental factor that affects the different aspects of the living organism. Different types of physiological activities such as enzymatic activities as well as geographical distribution of different species depends on the temperature conditions and levels of their thermal tolerance. Therefore, the living organism is required to maintain specific internal temperatures.

Related Theory
Temperature influences the distribution of species as the species are able to grow within a narrow range of temperature which is known as the optimum temperature. The organisms are able to survive by maintaining all biological processes within an optimum temperature. The primary factors that affect the organisms are temperature, water, humidity, p^H.

Question 12.
The available species inventories to estimate the global species diversity do not include the diversity of prokaryotic species. The biologists are still unaware of the total prokaryotic diversity. Why? Give reasons. (3)
Answer:
Biologists are still unaware of the total prokaryotic diversity because of the following reasons:

• The conventional taxonomic methods are not suitable for identifying microbial species.
• Many microbial species cannot be cultured under laboratory conditions.
• If biochemical or molecular criteria for delineating microbial species is accepted and followed, then their diversity alone might run into millions.

SECTION – C
(Section C has a case-based question of 5 marks.)

Question 13.
A school student trip was organized and students were taken to a sewage treatment plant, where the students observed the treatment of sewage before it can be discharged into rivers.
Based on this, answer the following questions:

(A) What do you mean by waste water?
(B) Why reduction in BOD is required in the treatment of sewage water?
(C) The process which involves removal of large and small particles through filtration and sedimentation is called as?
(D) State two advantages of sewage treatment plants.
OR
Rekha observed the following pictures of microbes showing virus and bacteria. On seeing these pictures, it reminded her of the beginning of the Covid-19 pandemic. She started cursing microbes as she thought that they are a curse on this earth. But her teacher told her that all the microbes are not harmful for us. Microorganisms are very useful as they provide various medicines, household products, bioactive molecules, etc.

Based on this answer the following questions:

(A) (i) Apart from making curd, what is the function of microbe Lactobacillus1
(ii) Name any two enzymes produced by microbes that are used for clarification of bottled juices.

(B) (i) Name the fungus from which first antibiotic was isolated.
(ii) Write any two roles served by Saccharomyces cerevisiae. (5)
Answer:
(A) Waste water is the water that is produced after the use of fresh water by human beings for variety of applications such as domestic, commercial and industrial use.

(B) The greater the BOD of sewage water, more is its polluting potential. So, the sewage water is treated, till its BOD is reduced to reduce the organic matter present in it.

(C) The process which involves removal of large and small particles through filtration and sedimentation is called as primary treatment of sewage.

(D) The advantages of sewage treatment plants (STPs) are:
(i) STPs preserve natural environment against pollution.
(ii) STPs eliminate disease-causing bacteria and kills harmful organisms from the sewage water before its discharge into the rivers. In this way, STPs reduces risk to public health and the environment.
OR
(A) (i) Lactobacillus increases the nutritional value of the curd by increasing the amount of vitamin B₁₂ in it.
(ii) Two enzymes produced by microbes that are used for clarification of bottled juices are pectinase and protease.

(B) (i) The fungus/mould from which first antibiotic was isolated was Penicillium notatum.
(ii) Two roles of Saccharomyces cerevisiae are:
(i) It is used in bread making.
(ii) It is used in the commercial production ofethanoL
Related Theory
Saccharomyces cerevisiae is also known as baker’s and brewer’s yeast.

Students can access the CBSE Sample Papers for Class 12 Geography with Solutions and marking scheme Term 2 Set 7 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Geography Term 2 Set 7 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 35
Roll No. ___________

General Instructions:

• Question paper is divided into 5 sections A, B, C, D & E
• In section A, question number 1 to 3 are Very Short Answer type questions. Attempt any 3 questions.
• In section B, question number 4 is Source based question.
• In section C, question number 5 & 6 are Short Answer type questions.
• In section D, question number 7 to 9 are Long Answer type questions.
• In section E, question number 10 is a Map based question.

Section – A
Very Short Answer Questions

Question 1.
How does consumer cooperatives, departmental stores contribute to trade and commerce in a region? (2)
Or
Explain the different factors that affect transport.
Answer:
Consumer cooperatives and departmental stores contribute to trade and commerce in a region in following ways

• Consumer cooperatives were the first of the large-scale innovations in retailing.
• Departmental stores delegate the responsibility and authority to departmental heads for purchasing of commodities and for overseeing the sale in different sections of the stores.

Or
There are two important factors that affect transport

• Demand for Transport It is influenced by the size of population. The larger the population size, the greater is the demand for transport
• Routes It depends on location of cities, towns, villages, industrial centres and raw materials, pattern of trade between them, nature of the landscape between them, type of climate, and funds available for overcoming obstacles along the length of the route.

Question 2.
Briefly describe the steps taken by the Indian railways to revolutionise rail transport (2)
Answer:
A few steps taken by Indian railways to revolutionise rail transport are

• Indian Railways has launched extensive programme to convert the metre and narrow gauges to broad gauge.
• Moreover, steam engines have been replaced by diesel and electric engines. This step has increased the speed, as well as, the haulage capacity.

Question 3.
Define air pollution and its sources. (2)
Answer:
Air pollution is the addition of contaminants, like dust, fumes, gas, fog, odour, smoke or vapour to the air in substantial proportion and duration that may be harmful to flora and fauna and to property. Combustion of fossil fuels, mining and industries are the main sources of air pollution These processes release oxides of sulphur and nitrogen, hydrocarbons, carbon dioxide, carbon monoxide, lead and asbestos.

Section – B
Source Based Question

Question 4.
Read the source given below and answer the following questions by choosing the correct option.
Bio-energy refers to energy derived from biological products which includes agricultural residues, municipal, industrial and other wastes. Bioenergy is a potential source of energy conversion. It can be converted into electrical energy, heat energy or gas for cooking.

It will also process the waste and garbage and produce energy. This will improve economic life of rural areas in developing countries, reduce mental pollution, enhance self-reliance and reduce pressure on fuel wood. One such project converting municipal waste into energy is Okhla in Delhi.

The challenge of sustainable development requires integration of quest for economic development with environmental concerns. Traditional methods of resource use result into generating enormous quantity of waste as well as create other environmental problems. Hence, for sustainable development calls for the protection of resources for the future generations.

There is an urgent need to conserve the resources. The alternative energy sources like solar power, wind, wave, geothermal energy are inexhaustible resource. These should be developed to replace the exhaustible resources. In case of metallic minerals, use of scrap metals will enable recycling of metals. Use of scrap is specially significant in metals like copper, lead and zinc in which India’s reserves are meagre. Use of substitutes for scarce metals may also reduce their consumption. Export of strategic and scarce minerals must be reduced, so that the existing reserve may be used for a longer period.

i. What are the economic implications of bio-energy for rural community? (1)
Answer:
Economic implications of bio energy for rural community are reducing reliance on fuel wood, increasing availability of non-wood energy and reducing environmental damage and associated cost.

ii. Why do we need alternatives to conventional fuel resources such as fossil fuels? (1)
Answer:
We need alternatives to conventional fuel resources such as fossils fuels because conventional fuel resources led to pollution.

iii. Why should export of rare and scarce minerals be reduced? (1)
Answer:
Export of rare and scare minerals should be reduced for extended use of existing reserves in a region.

Section – C
Short Answer Questions

Question 5.
Explain agro based industries and agri-business. (3)
Or
What do you mean by large integrated industry and mini-steel mills. Outline the distribution of iron and steel industry in Asia.
Answer:
Agro-based Industries involves the processing of raw materials from the field and the farm into finished products for rural and urban markets. Major agro-processing industries are food processing, sugar, pickles, fruits juices, beverages (tea, coffee and cocoa), spices and oils fats and textiles (cotton, jute, silk), rubber, etc.

Agro processing includes carning producing cream, fruit processing and confectionery, While some preserving techniques, such as drying, fermenting and pickling, have been known since ancient times, these had limited applications to cater to the pre-Industrial Revolution demands.

Agri-business is commercial farming on an industrial scale often financed by business whose main interests lie outside agriculture, for example, large corporations in tea plantation business. Agri-business farms are mechanised, large in size, highly structured, reliant on chemicals, and may be described as ‘agro-factories’.
Or
The large integrated steel industry is traditionally located close to the sources of raw materials which are iron ore, coal, manganese and limestone or at places where these could be easily brought, e.g. near ports. On the other hand in mini steel mills, access to markets is more important than inputs. These are less expensive to build and operate and can be located near markets because of the abundance of scrap metal, which is the main input.

Traditionally, most of the steel was produced at large integrated plants, but mini mills are limited to just one-step process steel making, and are gaining ground. In Asia, the important centres of iron and steel industry include Nagasaki and Tokyo-Yokohama in Japan; Shanghai, Tienstin and Wuhan in China; and Jamshedpur, Kulti-Burpur, Durgapur, Rourkela, Bhilai, Bokaro, Salem, Visakhapatnam and Bhadravati in India.

Question 6.
Write a detailed note on Geothermal energy. (3)
Answer:
Geothermal energy is the head energy within the earth. When the magma from the interior of earth, comes out on the surface, tremendous heat is released. This heat energy can successfully be tapped and converted to electrical energy. Apart from this, the hot water that gushes out through the geyser wells is also used in the generation of thermal energy.

This energy is now considered to be one of the key energy sources which can be developed as an alternate source. The hot springs and geysers are being used since medieval period. In India, a geothermal energy plant has been commissioned at Manikaran in Himachal Pradesh.

Section – D
Long Answer Questions

Question 7.
A basic industry is responsible for providing raw material to other industries. They are important for a nation’s economy. Discuss the role of iron and steel industry as a basic industry and location of steel industries. Also explain about production of iron. (5)
Or
Elucidate the structure and distribution of cotton textile industries in the world.
Answer:
The iron and steel industry forms the base of all other industries and, therefore, it is called a basic industry. It is basic because it provides raw material for other industries such as machine tools used for further production and for building infrastructure in industries, transportation and residential settlements. It may also be called a heavy industry because it uses large quantities of bulky raw materials and its products are also heavy.

The large integrated steel industry is traditionally located close to the sources of raw materials i.e. iron ore, coal, manganese and limestone or at places where these could be easily brought, e.g. near ports. But in mini steel mills access to markets is more important than inputs. These are less expensive to build and operate and can be located near markets because of the abundance of scrap metal, which is the main input.

Traditionally, most of the steel was produced at large integrated plants, but mini mills are limited to just one-step process i.e. steel making Iron is extracted from iron ore by smelting in a blast furnace with carbon (coke) and limestone. The mineral ores commonly used for iron production are hematite and magnetite. Naturally, iron ores are found in Banded Iron Formations (BIFs) which are sedimentary rocks of Precambrian.

The molten iron is cooled and moulded to form pig iron which is used for converting into steel by adding strengthening materials like manganese. Cotton is the world’s most important fibre which is used for production of several products including textiles. Cotton textile industry has three sub-sectors i.e. handloom, powerloom and mill sectors

1. Handloom sector is labour-intensive and provides employment to semi-skilled workers. It requires small capital investment. This sector involves spinning, weaving and finishing of the fabrics.
2. The powerloom sector introduces machines and becomes less labour intensive and the volume of production increases.
3. Cotton textile mill sector is highly capital intensive and produces fine clothes in bulk.

Cotton textile manufacturing requires good quality cotton as raw material. Cotton textile industries produces two types of products, i.e. cotton yarn and cotton cloth. These industries are spread globally in over 90+ countries, however India, China, USA, Pakistan, Uzbekistan and Egypt produce more than half of the world’s raw cotton China and India also lead the global production of cotton yarn and cloths. The UK, NW European countries and Japan also produce cotton textile made from imported yarn. Europe alone accounts for nearly half of the world’s cotton imports.

Question 8.
State the global distribution of railways in the continents of the world. (5)
Answer:
The global distribution of railways in the world is

Europe has one of the most dense rail networks in the world. There are about 4,40,000 km of railways, most of which is double or multiple-tracked. The important rail heads are London, Paris, Brussels, Milan, Berlin and Warsaw. Passenger transport is more important than freight in many of these countries.

In Russia, railways account for about 90 percent of the country’s total transport with a very dense network west of the Urals. Moscow is the most important rail head with major lines radiating to different parts of the country’s vast geographical area.

North America has one of the most extensive rail networks accounting for nearly 40 per cent of the world’s total. The railways are used more for long-distance bulky freight like ores, grains, timber and machinery than for passengers. The most dense rail network is found in the highly industrialised and urbanised region of East Central U.S.A. and adjoining Canada.

Australia has about 40,000 km of railways, of which 25 per cent are found in New South Wales alone. The west-east Australian National Railway line runs across the country from Perth to Sydney. New Zealand’s railways are mainly in the North Island to serve the farming areas.

In South America, the rail network is the most dense in two regions, namely, the Pampas of Argentina and the coffee growing region of Brazil which together account for 40 per cent of South America’s total route length. Only Chile, among the remaining countries has a considerable route length linking coastal centres with the mining sites in the interior.

Question 9.
Highlight the importance of roads in land transport. (5)
Answer:
The importance of roads in land transport is

1. Roads in land transport are the most economical for short distances compared to railways.
2. Freight transport by road is important because it offers door-to-door service.
3. Roads play a vital role in a nation’s trade and commerce and for promoting tourism.
4. The quality of the roads varies greatly between developed and developing countries because road construction and maintenance require heavy expenditure.
5. In developed countries good quality roads are universal and provide long-distance links in the form of motorways, autobahns (Germany), and inter-state highways for speedy movement.
6. Lorries, of increasing size and power to carry heavy loads are common.
7. Road transport is most flexible and adaptable with an outreach into the most remote areas that are inaccessible by rail, air or water.

Section – E
Map Based Question

Question 10.
On a political map of India locate and label the following features (Attempt any 5). (1 × 5 = 5)
(i) Bokaro coal mines
(ii) Important town of Golden Quadrilateral in the North
(iii) Northernmost node in the North-South Corridor
(iv) Balaghat manganese mines
(v) Khetri copper mines
(vi) Barauni oil refinery
Answer:

Students can access the CBSE Sample Papers for Class 12 Physics with Solutions and marking scheme Term 2 Set 4 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Physics Standard Term 2 Set 4 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 40

General Instructions:

• There are 12 questions in all. All questions are compulsory.
• This question paper has three sections: Section A, Section B, and Section C.
• Section A contains three questions of two marks each, Section B contains eight questions of three marks each, Section C contains one case study-based question of five marks.
• There is no overall choice. However, an internal choice has been provided in one question of two marks and two questions of three marks. You have to attempt only one of the chokes in such questions.
• You may use log tables if necessary but use of calculator is not allowed.

SECTION – A
(Section A contains 3 questions of 2 marks each.)

Question 1.
What is an ideal diode and draw the output waveform across R for the input waveform given below? (2)

Answer:
The diode offering zero resistance in forward bias, infinite resistance in reverse bias and having no potential barrier ideal diode. In the first half cycle the diode is forward biased and conducts, shown output is obtained across r, while in the next half-cycle the diode is reverse biased does not conduct, so no output is obtained across R.

Question 2.
In the given fusion reaction, find the mass defect, Q-value and state whether the fusion is energetically favorable? He⁴+He⁴ → Be⁸
m (Be⁸) = 8.0053 u and m(He⁴) = 4.0026 u.
OR
In Young’s double-slit experiment, plot a graph showing the variation of fringe width versus the distance of the screen from the plane of the slits keeping other parameters same. What type of information can we obtain from slope of the curve? (2)
Answer:
He⁴, He⁴ →, Be⁸ + Q
Δm=2 x 4.0026-8.0053 = 8.0052-8.0053
=-0.0001
Q=(2m_He — m_He)c = (2 x 4.0026 – 8.0053) x 931.5 MeV = – 931.5 KeV
Since Q is negative, the fusion is not energetically favorable.
OR
The fringe width in Young’s double-slit experiment is given by
β = \(\frac{\lambda D}{d}\)
D = distance between slit and screen
d = distance between slits

So, β ∝ D
It is linear graph with slope \(\frac{\lambda}{d}\) . So the fringe width to vary Linearly with distance of screen from the slits, the ratio of wavelength to distance between the slits should remain constant. Therefore, it is advised to take wavelengths incident light nearly equal to the width of the slit.
Related Theory:
In Youngs double-slit experiment fringe width is directly proportional to the distance of screen the slit.

Question 3.
Describe a reflecting type telescope and mention its advantages. (2)
Answer:
Cassegrain telescope is a reflecting type telescope.

Telescopes with mirror objectives are called reflecting telescopes. Advantages of taking mirror objectives are:
(A) There is no chromatic aberration in mirrors.
(B) MechanicaL support is much less of a problem since Lens weighs more than mirror of equal. equivalent optical quality.
(C) If a parabolic reflecting surface is chooser, spherical aberration is also removed.

Related Theory
The Largest reflecting telescope in the world ore the pair of rack telescopes in Hawai USA. with reflectors
of 10 meters in diameter.

SECTION – B
(Section B consists of 8 questions of 3 marks each.)

Question 4.
An electron and a photon each have a wavelength of 1.50 nm. Find:
(A) their momentum.
(B) the energy of the photon.
(C) the kinetic energy of the eLectron. (3)
Answer:
(A) For each electron or photon, momentum,
p = \(\frac{h}{\lambda} \)
= \(\frac{6.63 \times 10^{-34}}{1.5 \times 10^{-9}}\)
= 4.42 x 10^-25kg\(\frac{m}{\text { sec }}\)

(B) E = \(\frac{h c}{\lambda}\)
= \(\frac{\left.\left.6.63 \times 10^{-34}\right) 3 \times 10^{8}\right) e V}{\left(1.5 \times 10^{-9}\right)\left(1.6 \times 10^{-19}\right)}\)
= 828.75 eV

(C) E_k = \(\frac{1}{2} \frac{p^{2}}{m}\)
= \(\frac{1\left(4.42 \times 10^{-25}\right)^{2}}{2 \times 9.1 \times 10^{-31} \times 1.6 \times 10^{-19}}\)eV
= 0.671 eV

Question 5.
(A) Prove the behavior of a plane wavefront by using Huygens’s geometrical construction when:
(i) passing through o biconvex lens and
(ii) reflecting by a concave mirror.
(B) ExpLain why the refracted Light have the same frequency as that of the incident Light when monochromatic Light is incident on a surface separating two media.
OR
How can we convert a full-wave rectifier to a half-wave rectifier changing the connection of wires? (3)
Answer:

(B) The frequency and time period of an electromagnetic wave depends only on the source which produces it. The frequency is independent of the medium through which it travels. But the speed and wavelength depend on the medium through which the wave travels. Because of this, the frequency and time period of sound wave does not change due to change in the medium.
OR
If we change the connection of load resistance from point C to point B due to which no current will flow through second diode in second half cycle.

Related theory:
As the connection is altered, only one diode will be functional which Will result in decrease in efficiency
of the diode, and the output voltage will be cut down to exactly half.

Question 6.
(A) What is the significance of negative signs in the expression for the energy?
(B) Draw the energy level diagram showing how the line spectra corresponding to Paschen series occur due to transition between energy levels. (3)
Answer:
(A) Negative sign indicates that revolving electron is bound to the positive nucleus.
(B) For Paschen series, n = 3 and n_i = 4, 5,..
\(\frac{1}{\lambda}=\mathrm{R}\left(\frac{1}{3^{2}}-\frac{1}{n_{i}^{2}}\right)\)
where, n_i= 4, 5 ……………………..
Total energy, E (eV)

Question 7.
(A) What is the nature of the final image in a compound microscope?
(B) You are given two converging lenses of focal lengths 1.25 cm and 5 cm to design a compound microscope.
If it is desired to have a magnification of 30, find out the separation between the objective and the eyepiece? (2)
Answer:
(A) The final image in a compound microscope is inverted with respect to the object. It is
virtual and magnified.
(B) Given, f_e= 5 cm;
f₀= 1.25 cm
and M=-30.
Let L be the tube length (distance between the objective and the eyepiece).
∴ M = \(\frac{-L}{f_{0}}\left(1+\frac{d}{f_{e}}\right)\)
[d is a constant and equals to the normal distance of clear vision of the human eye].

Hence, -30 = \(-\frac{L}{1.25}\left(1+\frac{25}{5}\right)\)
∴ L = \(\frac{30 \times 1.25}{6}\)
= 6.25 cm
Hence, the tube [ength = 6.25 cm.

Caution
Students are often confused about the separation of objective and eyepiece. Tube Length is the separation between the objective and the eyepiece.

Question 8.
(A) How does the fringe width, in Young’s double-slit experiment change when the distance of separation between the slits and screen is doubled?
(B) In Young’s double-slit experiment maximum intensity is lo, find the intensity at a point on the screen where
(i) the phase difference between the two interfering beams is \(\frac{\pi}{3}\)
(ii) the path difference between them is \(\frac{\lambda}{4}\). (3)
Answer:
(A) Fringe width
β = \(\frac{\lambda D}{d}\)
⇒ β ∝ D
The fringe width becomes double when the distance of separation between the slits and screen is doubled.
(B) (A) I= I‘max Cos² \(\left(\frac{\phi}{2}\right)\)
Here I_max is I_o (i.e.. intensity due to independent sources is \(\frac{I_{0}}{4}\) .).

Therefore, at
Φ = \(\frac{\pi}{3}\)
or
\(\frac{\phi}{2}=\frac{\pi}{6}\)
I =I₀cos² \(\left(\frac{\pi}{6}\right)=\frac{3}{4}\) I₀

(B) Phase difference corresponding to the given path difference Δx = \(\frac{\lambda}{4}\) is
Φ = \(\left(\frac{2 \pi}{\lambda}\right)\left(\frac{\lambda}{4}\right)\)
= \(\frac{\pi}{2}\) (Φ = \(\frac{2 \pi}{\lambda} \Delta x\))
\(\frac{\phi}{2}=\frac{\pi}{4}\)
I = I₀ cos²\(\left(\frac{\pi}{4}\right)=\frac{I_{0}}{2}\).

Question 9.
Explain giving reasons for the following:
(A) Photoelectric current in a photocell increases with the increase in the intensity of the incident radiation.
(B) The stopping potential (V₀) varies linearly with the frequency (v) of the incident radiation for a given photosensitive surface with the slope remaining the same for different surfaces.
(C) Maximum kinetic energy of the photoelectrons is independent of the intensity of incident radiation. (3)
Answer:
(A) Since number of photo electrons emitted is directly proportional to the intensity of incident radiation, therefore, as intensity increases the electron-hole pairs also increases.

(B) hv = hv₀ + eV₀
eV₀= h(v – v₀)
⇒ V₀=\(\frac{h}{e}\) (v-v₀)

Further from graph,\(\frac{h}{e}\) slope is which is a constant and it does not depend on v.
KE_max = h(v – v₀)
Hence, it depends on the frequency and not on the intensity of the incident radiation.
(C) As intensity increases, the number of photons increases but the energy remains same.

Question 10.
Derive the expression for the wavelength of lines of different spectral series in H-atom.
OR
(A) In semiconductors, thermal collisions are responsible for taking a valence electron to the conduction band. Why does the number of conduction electrons not go on increasing with time as thermal collisions continuously take place?
(B) In a p-n junction, the depletion region is 400 nm wide and an electric field of 5 x 10⁵\(\frac{\mathrm{V}}{\mathrm{m}}\) exists in it. m
(i) What will be the height of the potential barrier?
(ii) What should be the minimum kinetic energy of a conduction electron which can diffuse from the n-side to the p-side? (3)
Answer:
10. By Bohr’s III concept
ΔE = E₂ – E₁
\(\frac{h c}{\lambda}\) = E₂ – E₁
\(\frac{1}{\lambda}=\frac{E_{2}-E_{1}}{h c}\) ……………………… (i)
E₂ = – \(\frac{m e^{4}}{8 \varepsilon_{0}^{2} h^{2}} \cdot \frac{1}{n_{2}^{2}}\) ………………. (ii)
E₁ = – \(\frac{m e^{4}}{8 \varepsilon_{0}^{2} h^{2}} \cdot \frac{1}{n_{1}^{2}}\) ………………………. (iii)

Putting (ii) and (iii) n equation (i), we get

(A) The presence of electrons in the conduction band saturates the further production of electron-hole pairs.
(B) (i) Height of potentiaL barrier =5 x 10⁵ V/m x 400 x 10^-9
= 0.2 V
(ii) Kinetic energy
=q x V= 1.6 x 10^-19 x 0.2
= 0.2 V

Question 11.
Angular width of central maxima in the Fraunhofer diffraction pattern of a slit is measured. The slit is illuminated by light of wavelength 6000 A. When the slit is illuminated by light of another wavelength, then the angular width decreases by 30%. Calculate the wavelength of this light. The same decreases in the angular width of central maximum is obtained when original apparatus is immersed in a liquid. Find the refractive index of the liquid. (3)
Answer:
An guiar width of central maximum
= \(\frac{2 \lambda}{a}\)
λ₁ = 6000 Å = 60 nm,
θ₁ = \(\frac{2 \lambda_{1}}{a}\)
θ₂ = θ₁ x 0.7
= \(\frac{2 \lambda_{1}}{a}\)

On dividing both the equations, we get
\(\frac{1}{0.7}=\frac{\lambda_{1}}{\lambda_{2}}=\frac{600}{\lambda_{2}}\)
λ₂ = 420 nm
When apparatus is under liquid,

The refractive index of the given medium is 1.42.

SECTION – C
(Section C consists one case study-based question of 5 marks.)

Question 12.
A changing electric field produces a changing magnetic field and vice-versa which gives rise to a transverse wave known as electromagnetic waves. The time-varying electric field and magnetic field are mutually perpendicular to each other also perpendicular to the direction of propagation. Thus, the electromagnetic waves consist of sinusoidally time-varying electric and magnetic fields acting at right angles to each other as well as at right angles to the direction of propagation.

(A) The amplitudes of electric and magnetic fields in EM waves are E0 and Bo respectively.
They are related as:
(i) E₀ = \(\frac{\mathrm{B}_{0}}{c}\)
(ii) E₀ = cB₀
(iii) cE₀ = B₀
(iv) E₀ = c²B₀

(B) Electric and magnetic field vectors in EM waves are:
(i) perpendicular to each other
(ii) parallel to each other
(iii) 270° to each other
(iv) 180° to each other

(C) A plane electromagnetic wave of frequency 25 MHz travels in free space along the x-direction. At a particular point in space and time E = 6.3 \(\hat{j} \frac{v}{m}\) the B at this point is:

(D) If E and B represent electric and magnetic field vectors of the electromagnetic waves, then the direction of propagation of the electromagnetic waves is that of:
(i) E
(ii) B
(iii) E x B
(iv) B x E

(E) In an electromagnetic wave, the electric and magnetic fields are 100 V/m and 0.265 A/m.
The maximum energy flow is:
(i) 79 \(\frac{W}{m^{2}}\)
(ii) 13.2 \(\frac{W}{m^{2}}\)
(iii) 53.0 \(\frac{W}{m^{2}}\)
(iv) 26.5 \(\frac{W}{m^{2}}\) (5)
Answer:
(A) (b) E₀ = cB₀
Explanation: Electric field and magnetic field vectors in an electromagnetic wave is related as \(\frac{E}{B}\) = c where c s the speed of light. The electromagnetic waves travel with the speed of Light.

(B) (a) Perpendicular to each other Explanation: The angle between electric and magnetic field vectors in EM waves is 900.

(C) (b) 2.1 x 10^-8 \(\hat{k}\)T
Explanation: f’ = 25 MHz = 25 x 10⁶ Hz,
E=6.3 \(\hat{j} \frac{v}{m}\)
E₀ = 6.3
\(\left(\frac{E_{0}}{B_{0}}\right)\) = c

∴ E is along y-direction and wave is along x-direction hence B has to be perpendicular to both x and y axes. E x B should be along the x-direction. B shouLd be along z-direction B = B₀ k
B=2.1 x 10^-8\(\hat{k}\) T

(D) (c) E x B
Explanation: The electric field and the magnetic field of an electromagnetic wave are mutually perpendicular to each other and their direction of propagation is perpendicular to both the electric and magnetic fields. If E and B represent electric and magnetic field vectors of electromagnetic waves respectively, then the direction of propagation of the electromagnetic wave is along the direction of vector E x B.

Caution:
Students are often confused about the vector product of two quantities The vector product B x E gives the negative direction of the propagation of wove. The electric and magnetic fields of an electromagnetic wave are perpendicular to each other and also perpendicular to the direction of wave propagation.
Hence these are transverse waves.
(E) (d) 26.6 \(\frac{W}{m^{2}}\)

Explanation: Here, amplitude of electric field,
E₀ = 100\(\frac{V}{m}\)
Amplitude of magnetic field,
B₀ =0.265 \(\frac{A}{m}\)
The maximum rate of energj flow,
S = E₀ x B0 = 100 x 0.265
= 26.5 \(\frac{W}{m^{2}}\).

Students can access the CBSE Sample Papers for Class 12 Chemistry with Solutions and marking scheme Term 2 Set 9 will help students in understanding the difficulty level of the exam.

CBSE Sample Papersn for Class 12 Chemistry Term 2 Set 9 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 35

General Instructions:

• There are 12 questions in this question paper with internal choice.
• SECTION A – Q. No. 1 to 3 are very short answer questions carrying 2 marks each.
• SECTION B – Q. No. 4 to 11 are short answer questions carrying 3 marks each.
• SECTION C- Q. No. 12 is case based question carrying 5 marks.
• All questions are compulsory.
• Use of log tables and calculators is not allowed.

Section – A
(Section A-Question No 1 to 3 are very short answer questions carrying 2 marks each.)

Question 1.
Explain what is observed:
(A) When a beam of light is passed through a colloidal solution.
Answer:
When a beam of light is passed through a colloidal solution, the path of the beam gets illuminated by bluish light and this is known as Tyndall effect.

(B) Electric current is passed through solution. (2)
Answer:
When the electric current is passed through colloidal solution movement of the colloidal particles either towards the cathode or towards the anode takes place. This is known as electrophoresis. Explanation: The Tyndall effect is the phenomenon in which the particles in a colloid scatter the beams of light that are directed at them. This effect is exhibited by all colloidal solutions and some very fine suspensions. Thus the identity of the colloidal solutions is determined by this effect. The density of the colloidal particles as well as the frequency of the incident light determines the intensity of the colloidal solutions.

Question 2.

Observe the above graph and explain the variation of conductivity with concentration for strong and weak electrolyte. (2)
Answer:
Variation of conductivity depends on the concentration of the electrolyte. The conductivity and Molar conductivity of both weak and strong electrolytes decreases with decrease in concentration as the number of ions per unit volume carrying the current in a solution decreases on dilution.

For strong electrolytes number of ions per unit volume are high as they completely dissociate in solution. With dilution the interionic forces decrease therefore ionic mobility increases.
For weak electrolytes extent of dissociation is very small and with dilution the dissociation increases slowly but the value of molar conductivity at infinite dilution cannot be obtained as in the case of strong electrolyte.

Question 3.
Carry out the following conversions: (Any two)
(A) Methyl chloride to Acetic acid
Answer:

(B) Benzene to benzoic acid
Answer:

(C) Ethanol to Acetone. (2)
Answer:

Section – B
(Section B-Question No 4 to 11 are short answer questions carrying 3 marks each.)

Question 4.
(A) Calculate the rate of the reaction for the rate law -d[A]/ dt = K [A].[B]², when the concentration of A and B are 0.1 M and 0.02 M respectively and K = 5.1 × 10^-3 L² s^-1 mol^-2.
(B) What is the order of the reaction for the graph given below, What does the slope depict for a graph between In [A] and time. (3)

Answer:
(A) Given that
Rate of reaction
\(\frac{\mathrm{d}[\mathrm{A}]}{\mathrm{dt}}\) = K [A], [B]²

Given K = 5.1 × 10^-3 L²s^-1 mol^-1
[A] = 0.1 M, [B] = 0.02 M, then
– \(\frac{\mathrm{d} \mathrm{A}}{\mathrm{dt}}\) = 5.1 × 10^-3 × 0.1 × (0.02)²
= 0.00204 × 10^-3
= 2.04 × 10^-7 Ms^-1

(B) For first-order reactions, the equation ln[A] = -kt + ln[A]₀ is similar to that of a straight line. (y = mx + c) with slope -k. Thus, the graph for ln[A] v/s t for a first-order reaction is a straight line with slope -k

Question 5.
(A) Differentiate between physical and Chemical Adsorption.
(B) What does the following graph depict about adsorption.

OR
Give reason for the following:
(A) Finely divided substances are more effective as adsorbents.
(B) Lyophilic colloids are also called reversible sols.
(C) Agl sol, formed after AgNO₃ reacts with Kl, is negatively charged. (3)
Answer:
(A)

Physical Adsorption	Chemical Adsorption
1. Vander Waals force acts between adsorbate and adsorbent	1. Chemical force acts between adsorbate and adsorbent
2. It is reversible in nature.	2. It is irreversible in nature.
3. It is not specific	3. It is highly specific
4. Requires low activation energy	4. Requires high activation energy
5. Multilayers of adsorbed parti­cles are formed	5. Monolayer of adsorbed parti­cles is formed
6. It has low heat of adsorption (20 to 40 kJ/ mol).	6. It has high heat of adsorption (40 to 200 kJ/ mol).

(B) The Freundlich equation or Freundlich adsorption isotherm is shown in the graph and adsorption isotherm, is an empirical relation between the concentration of a solute on the surface of an adsorbent to the concentration of the solute in the liquid with which it is in contact.
OR
(A) The finely divided substance is more effective as an absorbent because more the surface area more is the extent of adsorption. So they act as good adsorbents.

(B) Lyophilic colloids are also called reversible sols because once separated these can be reformed by simple mixing. Thus due to this reversible property they are also regarded as reversibel sols.

(C) When silver nitrate (AgNO₃) solution is added to Kl solution, a negatively charged sol is formed. It is due to the preferential adsorption of I_– ions and thus the Agl sol formed is negatively charged in nature.

Question 6.
(A) Give any two differences between double salts and complexes?
(B) Explain how [FeF₆]^3- is paramagnetic outer orbital complex. (3)
Answer:
(A) The difference between Double salt and Complex compound are:

Double Salt	Complex Compound
1. These exit only in solid state and dis­sociate into constituent species in their solution.	1. They retain their identity in solid as well as in solution state.
2.  lose their identity in dissolved state.	2. They do not lose their identity in dissolved state.

(B) In [FeF₆]^3-
Oxidation number of Fe = +3
Coordination Number Fe = 6
Coordination orbitals = 6
Fe → Fe³⁺ + 3e^–
Fe³⁺ → (26-3) – [Ar]₁₈
[FeF₆]^3- – (Strongly Paramagnetic)

Here F is a weak field ligand and it obeys Hund’s rule of leaving maximum number of unpaired electrons (n = 5) and it uses one 4s, three 4p and two 4d orbitals which are sp³ d² hybridised. So it is an outer orbital complex.

Question 7.
(A) What is the role of pyridine in the acylation reaction of amines ?
(B) Why is NH₂ group of aniline acetylated before carrying out nitration? Explain with the help of reactions.
OR
Predict the product for the reaction of:
(A) Aniline with bromine in non-polar solvent such as CS₂.
(B) C₆H₅CH₂NH₂ reacts with HNO₂
(C) Reduction of nitriles with LiAlH₄ (3)
Answer:
(A) Pyridine and other bases are used to remove the side product i.e., HCl formed during reaction mixture.

(B) Direct nitration of aniline is not possible on account of oxidation of —NH₂ group. However, nitration can be carried after protecting the —NH₂ group by acetylation to give acetanilide which is then nitrated and finally hydrolysed to give o-and p-nitroanilines.

The acetyl group being electron withdrawing attracts the lone pair of electrons of the N-atom towards carbonyl group.

As a result the activating effect —NH₂ group is reduced i.e., the lone pair of electrons on nitrogen is less available for donation to because to benzene ring by resonance. Therefore, activating effect of the —NHCOCH₃ group is less than that of the — NH₂ group.
OR

(C) Reduction of nitriles with sodium alcohol or LiAlH₄ gives primary amine RNH₂

Question 8.
(A) Decide giving reason which one of the following pairs exhibits the property indicated:
(i) Sc³⁺ or Cr³⁺ (exhibits paramagnetism)
(ii) V or Mn (exhibits more number of oxidation states)
(iii) V⁴⁺ or V⁵⁺ (exhibits colour) (3)
Answer:
(A) Cr³⁺ exhibits parai4iognetism due to the presence of 3 unpaired electrons in 3d orbitals

Explanation:
Electronic configuration
Sc³⁺ : [Ar] 3d° 4s° – No unpaired electron
Cr³⁺ : [Ar] 3d³ 4s° – Three unpaired electrons

(B) Mn shows maximum oxidation states (+2 to +7)
Explanation:
Electronic configuration:
V : [Ar] 3d³ 4s² (5 electrons can participate in bonding)
Mn : [Ar] 3d⁵ 4s² (7 electrons can participate in bonding)

(C) V⁴⁺ shows colour due to the presence of one unpaired electron in 3d orbital which undergoes d-d transition. V⁵⁺ does not have any unpaired electron.

Question 9.
Account for the following observations:
(A) pkb value for aniline is more than that for methylamine.
(B) Methylamine in water reacts with ferric chloride to precipitate ferric hydroxide
(C) Aniline does not undergo Friedel-Craft’s reaction. (3)
Answer:
(A) Aniline undergoes resonance and as a result, the electrons on the N-atom are delocalized over the benzene ring. Therefore, the electrons on the N-atom are less available to donate. In case of methylamine (due to the +1 effect of methyl group), the electron density on the N-atom is increased. As a result, aniline is less basic than methylamine. Thus, pKb of aniline is more than that of methylamine.

(B) Methylamine in water reacts with ferric chloride to precipitate hydrated ferric oxide. Due to the +1 effect of -CH₃ group, methylamine is more basic than water. Therefore, in water, methylamine produces OH- ions by accepting H+ ions from water. OH” ions react with ferric chloride to precipitate hydrated ferric oxide.

(C) Aniline does not undergo Friedel Craft’s reactions because the reagent AlCl₃ (a Lewis acid which is used as a catalyst in Friedel Crafts reaction), being electron deficient acts as a Lewis base, and attacks on the Lone pair of nitrogen present in aniline to form an insoluble complex which precipitates out and the reaction does not proceed.

Question 10.
Give reasons for the following:
(A) Transition elements act as catalysts
(B) It is difficult to obtain oxidation state greater than two for Copper.
(C) CrO is basic but Cr₂O₃ is amphoteric.
OR
Observed and calculated values for the standard electrode potentials of elements from Ti to Zn in the first reactivity series are depicted in following figure:

Explain the following observations:
(A) The general trend towards less negative E°values across the series
(B) The unique behaviour of Copper
(C) More negative E° values of Mn and Zn (3)
Answer:
(A) Due to large surface area and ability to show variable oxidation states Transition elements act as catalysts due to the large surface area and ability to show variable oxidation states.

(B) Due to high value of third ionisation enthalpy. It is difficult to obtain oxidation state greater than two for Copper because the value of third ionisation enthalpy is very high for a copper atom.

(C) Oxidation state of Cr in Cr₂O₃ is +3 and of CrO is +2. When oxidation number of a metal increases, ionic character decreases so CrO is basic while Cr₃O₃ is amphoteric. CrO is basic but Cr₂O₃ is amphoteric because oxidation state of Cr in Cr₂O₃ is +3 and of Cr in CrO is +2. When oxidation number of a metal increases, ionic character decreases so CrO is basic while Cr₂O₃ is amphoteric.
OR
(A) The general trend towards less negative E° values across the series is related to the general increase in the sum of the first and second ionisation enthalpies.

(B) The high energy to transform Cu(s) to Cu²⁺(aq) is not balanced by its hydration enthalpy.

(C) The stability of the half-filled d sub-shell in Mn²⁺ and the completely filled d¹⁰ configuration in Zn²⁺ are related to their more negative E° values.

Question 11.
A 0.25 M KOH solution offered a resistance of 31.6 ohms in a conductivity cell at 298 K. If the cell constant of the conductivity cell is 0.367cm^-1, find out the specific and molar conductance of the potassium hydroxide solution.
OR
Calculate emf and ∆G for the following reaction at 298 K:
Mg_(s)/Mg²⁺(0,01M) // Ag⁺(0.0001)/Ag_(s)
Given E° (Mg²⁺/Mg) = -2.37 V;
E° (Ag⁺/Ag) = +0.80 V (3)
Answer:
Resistance (R) = 31.6 ohm
Conductance (C) = 1/R = 1/31.6 ohm = 0.0316 ohm^-1
Specific Conductance (K ) = Conductance × cell constant
= 0.0316 ohm^-1 × 0.367 cm^-1
= 0.0116 ohm^-1 cm^-1
Molar concentration (C)= 0.25mol/1L = 0.25 mol/10³ cm² = 0.25 × 10^-3 mol cm^-3

MolarConductivity ∧_m = \(\frac{k \times 1000}{c}\)
= \(\frac{0.0116 \times 1000}{0.25 \times 10^{-3}}\)
= 0.0464 × 10⁶
∧_m = 4.64 × 10⁴ Scm^-1 mol^-1
OR
E°_cell = E°_cathode – E°_anode = E°_(Ag+/Ag) – E°_(Mg²⁺
= + 0.80 V – (- 2.37V) = 3.17 V
∆G° = -n F E°cell
= – 2 × 96500 C mol^-1 × 3.17V
= -611810 C mol^-1 = -611810 J mol^-1
= -611.810 1G mol^-1

Section – C
(Section C- Question No 12 is case-based question carrying 5 marks.)

Question 12.
Read the passage given below and answer the following questions:
Oxidation of alcohols to aldehydes is partial oxidation; aldehydes are further oxidized to carboxylic acids. Conditions required for making aldehydes are heat and distillation. In aldehyde formation, the temperature of the reaction should be kept above the boiling point of the aldehyde and below the boiling point of the alcohol. Reagents useful for the transformation of primary alcohols to aldehydes are normally also suitable for the oxidation of secondary alcohols to ketones.

[0] = chromium-based reagent, activated DMSO, hypervalent iodide compound, TRAP or TEMPO
R¹ = alkyl or aryl substituent
R² = hydrogen, alkyl or aryl substituent
(A) Name the reagent which can be used to oxidise an alcohol to a ketone.
(B) Write the aldehyde and the ketone formed by the oxidation of propan-l-ol and propan-2-ol respectively.
(C) Propanal can be oxidized easily than propanone. Give reason.
(D) Give simple chemical tests to distinguish between the following pairs of compounds.
(i) Propanal and Propanone
(ii) Ethanal and Propanal
OR
How will you prepare the following compounds starting with benzene:
(i) Benzaldehyde
(ii) Acetophenone (5)
Answer:
(A) CrO₃ with heat

Caution
If a student writes PCC in place of CrO₃, it will be a wrong answer because PCC (mild oxidizing agent) can be used to oxidise a primary alcohol to an aldehyde.

(B) Proparial and Propanone

Explanation:
Propan-1-ol being a primary alcohol on oxidation gives propanal an oldehyde and Propan-2-ol being a secondary alcohol on oxidation gives propanone.

(C) The difference between an aldehyde and ketone is the presence of a hydrogen atom attached to the carbon-oxygen double bond in the aldehyde. Ketone doesn’t have that hydrogen attached. Due to electron-withdrawing nature of C=O group, C—H bond in aldehyde is weak and thus it can be easily oxidised to corresponding Corboxylic acid.

(D) (i) Propanal. (aldehyde) and propanone (ketone):
Propanol gives sâ.er mirror test with Totten’s reagent. Propanone does not gives this test.

(ii) Ethonal and proponat can be distinguished by Iodoforrn test. Ethanal gives a yellow precipitate of iodofirm with an aLkaline so4ution of NaOH. Propanal does not gives this test.

Students can access the CBSE Sample Papers for Class 12 Biology with Solutions and marking scheme Term 2 Set 1 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Biology Standard Term 2 Set 1 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 40

General Instructions:

• All questions are compulsory.
• The question paper has three sections and 13 questions. All questions are compulsory.
• Section-A has 6 questions of 2 marks each; Section-B has 6 questions of 3 marks each; and Section-C has a case-based question of 5 marks.
• There is no overall choice. However, internal choices have been provided in some questions. A student has to attempt only one of the alternatives in such questions.
• Wherever necessary, neat and properly labeled diagrams should be drawn.

SECTION – A
(Section A has 6 Questions of 2 marks each.)

Question 1.
Humans have innate immunity for protection against pathogens that may enter the gut along with food. What are the two barriers that protect the body from such pathogens? (2)
Answer:
Microbial pathogens enter the gut of humans along with food:

• Physical barriers: Mucus coating of the epithelium lining the gastrointestinal tract helps in trapping microbes entering our body.
• Physiological barriers: Acid in the stomach, saliva in the mouth prevent microbial growth.

Related Theory
The innate immune system is made of defense against infection which can be activated
immediately once a pathogen attacks. It is essentially made up of barriers that aim to keep viruses, bacteria, parasites, and other foreign particles out of our body or limit their ability to spread inside the body.
Caution
While answering, students should read properly that which type of barriers are asked, as in this question only gastrointestinal tract is involved, so only barriers related to it should be written in the answer.

Question 2.
A patient admitted in ICU was diagnosed to have suffered from myocardial infarction. The condition of coronary artery is depicted in the image below. Name two bioactive agents and their mode of action that can improve this condition.

Substantiate by giving two reasons as to why a holistic understanding of the flora and fauna in the cropland is required before introducing an appropriate biocontrol method. (2)
Answer:
Streptokinase (produced by the bacterium Streptococcus) is used as a ‘clot buster’ for removing dots from the blood vessels of patients who have undergone myocardial infarction.

Statins (produced by the yeast Monascus purpureus) acts by competitively inhibiting the enzyme responsible for synthesis of cholesterol and thus act as blood- cholesterol lowering agents.

Related Theory
Myocardial infarction is commonly known as a heart attack and is a deadly medical emergency, in which the heart muscle begins to die because it does not get enough blood flow due to a blockage in the arteries that supply blood to the heart. Blockage can be due to cholesterol deposition.
OR
Eradication of pests will disrupt predator- prey relationships, where beneficial predatory and parasitic insects which depend upon flora and fauna as food or hosts, may not be able to survive.

Holistic approach ensures that various life forms that inhabit the field, their life cycles, patterns of feeding and the habitats that they prefer are extensively studied and considered.

Related Theory
When biological methods are used for controlling plant diseases and pests it is termed as Biocontrol. The organic farmer is aware of the fact that eradication of pests is undesirable because in their absence the beneficiary predatory and parasitic insects that depend upon them as food or hosts will not be able to survive. Therefore, the use of biocontrol agents will greatly reduce our dependence on toxic and harmful chemicals and pesticides.

Question 3.
Identify the compound chemical structure is shown below. State any three of its physical properties. (2)

Answer:
It is Morphine.
Physically it appears as a white, odourless, crystalline compound.

Related Theory
Morphine acts as a depressant and slows down body functions. It is an effective sedative and a painkiller taken by patients who have undergone surgery.
It is generally consumed by snorting and injection.

Question 4.
Water samples were collected at points A, B and C in a segment of a river near a sugar factory and tested for BOD level. The BOD levels of samples A, B and C were 400 mg/L, 480 mg/L and 8 mg/L respectively. What is this indicative of? Explain why the BOD level gets reduced considerably at the collection point C? (2)

Answer:
At collection points A and B, the BOD level is high due to high organic pollution caused by sugar factory and sewage discharge.

At the collection point C, the water was released after secondary treatment/ biological treatment (where vigorous growth of useful aerobic microbes into floes consume the major part of the organic matter present in the river water or effluent due to sugar factory and sewage discharge).

Related Theory
The primary treatment is also known as physical treatment as it basically involves physical removal of small and large particles from the sewage with the help of techniques like filtration and sedimentation. The secondary treatment is also known as Biological Treatment because it involves the use of microbes for sewage treatment.

BOD can be defined as the amount of the oxygen that would be consumed if all the organic matter in one litre of water were oxidised by bacteria. The sewage water is treated till the BOD is reduced. Thus, indirectly, BOD is a measure of the organic matter present in the water. The greater the BOD of waste water, more is its polluting potential.

Question 5.
An ecologist study an area with population A, thriving on unlimited resources and showing exponential growth, introduced population B and C to the same area. What will be the effect on the growth pattern of the population A, B and C when living together in the same habitat? (2)

Answer:
This interaction will lead to competition between the individuals of population A,B and C for resources. Eventually the ‘fittest’ individuals will survive and reproduce.
The resources for growth will become finite and limiting, and population growth will become realistic.

Relcted Theory
Practically unlimited resources are not available to population of any species in order to permit exponential growth. Therefore, limited resources result in competition between individuals. A given habitat in nature, has enough resources to support a maximum possible number, beyond which no further growth is possible. This limit of nature is termed as nature’s carrying capacity (K) for that species in that habitat.

Question 6.
With the decline in the population of fig species it was noticed that the population of wasp species also started to decline. What is the relationship between the two and what could be the possible reason for decline of wasps?
OR
With the increase in the global temperature, the inhabitants of Antarctica are facing fluctuations in the temperature. Out of the regulators and the conformers, which of the two will have better chances of survival? Give two adaptations that support them to survive in the ambient environment? Give one suitable example. (2)
Answer:
The relationship between the plant and pollinator is called mutualism. Fig depends on wasp for pollination, and wasp depends on fig for food and shelter.
With the decline in population of figs, wasp loses its source of food and shelter.

Related Theory
In order to safe-guard the mutually beneficial system, plant-animal interactions involve co-evolution of the mutualists, i.e., the evolution of the flower and its pollinator species are tightly linked with one another. There is a tight relationship between species of fig trees and pollinator species of wasp. In this a particular fig species can be pollinated only by its ‘partner’ wasp species and no other species. The female wasp is benefltted by using the fruit as an oviposition (egg-laying) site and developing seeds within the fruit for nourishing its larvae. In return the wasp pollinates the fig inflorescence while searching for suitable egg-laying sites.

OR
Thermoregulation, Osmoregulation
Birds/mammals (any one)

Related Theory
w Conformers are the organisms which depends upon the changes in its external environment. Like aquatic animals change the osmotic concentration of the body fluids with that of the surrounding air, water osmotic concentration. They are also called as ectotherms as they depend on external sources of body heat since they cannot regulate their body temperature as per the variations in the external temperature. Examples: amphibians, reptiles,
fishes.

Regulators are the organisms that are capable of controlling their internal environment irrespective of their external surroundings to an extent. They are also called as endotherms as these animals depend on the internal heat generation for survival.

SECTION – B
(Section B has 6 Questions of 3 marks each.)

Question 7.
How do normal cells get transformed into cancerous neoplastic cells? Elaborate giving three examples of inducing agent.
OR
A person is suffering from a high grade fever. Which symptoms will help to identify if he/she is suffering from Typhoid, Pneumonia or Malaria? (3)
Answer:
Transformation of normal cells into cancerous neoplastic cells may be induced by following physical, chemical or biological agents causing DNA damage:

• Ionising radiations like X-rays and gamma rays
• Non-ionizing radiations like UV.
• Chemical carcinogens present in tobacco smoke
• Cellular oncogenes (c-onc) or protooncogenes, when activated under certain conditions cause cancer.

Viruses with oncogenes can transform normal cells to cancerous cells. (any 3)

Related Theory
The cell growth and differentiation in human body is a highly controlled and regulated process. But in cancerous cells, there is a breakdown of these regulatory mechanisms. The property by which normal cells differ from cancerous cells is contact inhibition by virtue of which contact with other cells inhibits their uncontrolled growth, whereas cancerous cells have lost this property. Therefore, the cancerous cells divide continuously to give rise to masses of cells called tumours or neoplasm.
OR
Answer:
If the person has sustained high fever (39° to 40°C), weakness, stomach pain, constipation, headache and loss of appetite, it is Typhoid.
If the person has fever, chills, cough and headache: and the lips and fingernails turn gray to bluish, it-is Pneumonia.
If the person has chills and high fever recurring every three to four days then, it is Malaria.

Related Theory
Typhoid: Bacterial infection caused by Salmonella typhi, which enter the small intestine through contaminated food and water and then migrate through blood to other organs.

Pneumonia: Bacterial disease caused by
Streptococcus pneumoniae and Haemophilus influenzae, which infects the alveoli of the lungs. The infection spreads to a healthy person by inhaling the droplets/aerosols that are released by an infected person.

Malaria is caused by Plasmodium (a tiny protozoan). The disease spreads from an infected individual to a healthy person through the vector female Anopheles mosquito. The malaria can become fatal if left untreated, by disrupting the blood supply to vital organs and thus may cause seizures, mental confusion, kidney failure, coma and even death.

Question 8.
Recognition of an antigenic protein of a pathogen or exposure to a pathogen occurs during many types of immune responses, including active immunity and induced active immunity. Specify the types of responses elicited when human beings get encountered by a pathogen. (3)
Answer:
When our body encounters an antigenic protein or a pathogen for the first time it produces a response which is of low intensity and our body retains memory of the first encounter.

• The subsequent encounter with the same pathogen elicits a highly intensified response carried out with the help of two special types of lymphocytes present in our blood, B-lymphocytes, and T-lymphocytes.
• The B-lymphocytes produce an army of proteins in response to these pathogens into our blood to fight with them. These proteins are called antibodies. The T-cells themselves do not secrete antibodies but help B-cells produce them.

Related Theory
Active Immunity: When an individual (host) is exposed to antigens in the form of living or dead microbes or other proteins. It results in the production of antibodies. This kind of immunity is slow and thus takes time to give its full effective response, but its effect is long lasting. It has no side effects.

The type of immune response produced by B-lymphocytes is termed as humoral immune response or antibody mediated immune response. The type of immune response produced by
T-lymphocytes is termed as Cell-mediated immune response or cell-mediated immunity (CMI).

Question 9.
In a pathological lab, a series of steps were undertaken for finding the gene of interest. Describe the steps, or make a flow chart showing the process of amplification of this gene of interest. (3)
Answer:
The flow chart shows the three steps involved in the process of PCR showing the following

• Denaturation The DNA strands are treated with a temperature of 94°C (Heat) and the strands are separated. Each of the two separated DNA strands act as a template for the synthesis of a new strand.
• AnneaLing The primers anneal to the complementary strands. This step is carried out at a slightly lower temperature of 40°C to 60°C.
• Extension The DNA polymerase facilitates the extension of the strands by adding dNTPs (deoxy nucleoside Triphosphates) complementary to those of the template DNA. Taq DNA Polymerase also requires Mg2+ as a cofactor.

Diagram : Polymerase Chain Reaction

Question 10.
(A) ‘The Evil Quartet’ describes the rates of species extinction due to human activities. Explain how the population of organisms is affected by fragmentation the habitats.
(B) Introduction of alien species has led to environmental damage and decline of indigenous species. Give any one example of how it has affected the indigenous species?
(C) Could the extinction of Steller’s sea
cow and passenger pigeon be saved by man? Give reasons to support your answer. (3)
Answer:
(A) When a large habitat is broken into small fragments due to various activities, mammals and birds requiring large territories and certain animals with migratory habitats are badly affected, leading to population decline.

(B) Nile perch introduced in Lake Victoria eventually led to the extinction of an ecologically unique assemblage of more than 200 species of cichild fish.

• Portheniumj Lantana/water hyacinth caused environmental damage and threat to our native species
• African catfish-Clarias gariepinus introduced for aquaculture purposes is posing a threat to the indigenous catfishes in our rivers. (Any one)

(C) Yes; Humans have overexploited natural resources for their ‘greed’ rather than need’ leading to extinction of these animals. Sustainable harvesting could have prevented extinction of these species.

Related Theory
Examples of habitat loss:
(i) The tropical rain forests which were once covering more than 14 per cent of the earth’s land surface, now cover only about 6 per cent of the total area due to their fast destruction.
(ii) The Amazon rain forest, that are called the ‘lungs of the planet’, harbouring millions of species, is being cut and destroyed for cultivating soya beans or for conversion to grasslands for raising beef cattle.

Question 11.
(A) The image shown below is of a sacred grove found in India. Explain how has human involvement helped in the preservation of these biodiversity rich regions.

(B) Value of Z (regression coefficient) is considered for measuring the species richness of an area. If the value of Z is 0.7 for area A ,and 0.15 for area B, which area has higher species richness and a steeper slope? (3)
Answer:
(A) India’s history of religious and cultural traditions emphasized the protection of nature. In many cultures, tracts of forest are set aside, all the trees and wildlife within are venerated and given total protection. Sacred groves in many states are the last refuges for a large number of rare and threatened plants.

(B) Area A will have more species richness and a steeper slope.

Related Theory
w Sacred groves are found in Khasi and Jaintia Hills in Meghalaya, Aravalli Hills of Rajasthan, Western Ghat regions of Karnataka and Maharashtra and the Sarguja, Chanda and Bastar areas of Madhya Pradesh.

The species-area relationship is found out using the slope. Slope of regression or regression coefficient is used to measure species richness along an area. In smaller regions, an analysis of species-area relationship shows that the values of slope of regressionis the same irrespective of the taxonomic assemblage or the region. Whereas when analysis is carried out in large areas the slope of regression was found to be much steeper. Very large areas like the entire continents, the analysis of the species-area relationships will result in a slope that is much steeper i.e., the Z values are in the range of 0.6 to 1.2.

Question 12.
The image below depicts the result of gel electrophoresis

If the ladder represents sequence length upto 3000 base pairs (bp),
(A) Which of the bands (I – IV) correspond to 2500 bp and 100 bp respectively?
(B) Explain the basis of this kind of separation and also mention the significance of this process. (3)
Answer:
(A) Band III corresponds to 2500 base pairs, and Band IV corresponds to lOObp.

(B) The fragments will resolve according to their size. The shorter sequence fragments would move farthest from well as seen in Band IV (100 bp) which is lighter as compared to Band III which is heavier being 2500 base pairs.
The significance of electrophoresis is to purify the DNA fragments for use in constructing recombinant DNA by joining them with cloning vectors.

Related Theory
The basis of gel electrophoresis is that the DNA fragments separate according to their size through sieving effect provided by the agarose gel. Therefore, the smaller the fragment size, the farther it moves.
The purified DNA fragments (containing gene of interest) are used in constructing recombinant DNA by joining them with cloning vectors with the help of DNA ligase.

SECTION – C
(Section C has a case-based question of 5 marks.)

Question 13.
Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single stranded DNA. BamHl is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’ and cleaves these sequences just after the 5’- guanine on each strand.
(A) What is the objective of this action?

(B) Explain how the gene of interest is introduced into a vector.

(C) You are given the DNA shown below.
5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’
If this DNA was cut with BamHl, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.

(D) A gene M was introduced into E.coli cloning vector PBR322 at BamH 1 site. What will be its impact on the recombinant plamids? Give a possible way by which you could differentiate non recombinant to recombinant plasmids.
OR
GM crops especially Bt crops are known to have higher resistance to pest attacks. To substantiate this an experimental study was conducted in 4 different farmlands growing Bt and non Bt-Cotton crops. The farm lands had the same dimensions, fertility and were under similar climatic conditions. The histogram below shows the usage of pesticides on Bt crops and non-Bt crops in these farm lands.

(A) Which of the above 4 farm lands has successfully applied the concepts of Biotechnology to show better management practices and use of agrochemicals? If you had to cultivate, which crop would you prefer (Bt or Non- Bt) and why?

(B) Cotton Bollworms were introduced in another experimental study on the above farm lands wherein no pesticide was used. Explain what effect would a Bt and Non Bt crop have on the pest.
(5)
Answer:
(A) The two different DNA molecules will have compatible ends to recombine.

(B) Restriction enzyme cuts the DNA of the vector and then ligates the gene of interest into the DNA of the vector.

(C) 2 fragments
5’ ATTTTGAG 3’5’GATCCGTAATGTCCT 3’ 3′ TAAAACTCCTAG 5’.3’GCATTACAGGA 5′

(D) BamHl site will affect tetracycline antibiotic resistance gene, hence the recombinant plasmids will lose tetracycline resistance due to inactivation of the resistance gene.
Recombinants can be selected from non recombinants by plating into a medium containing tetracycline, as the recombinants will not grow in the medium because the tetracycline resistance gene is cut.

Related Theory
Each restriction endonuclease acts by ‘inspecting’ the length of a DNA sequence. On finding its specific recognition sequence known as palindromic nucleotide sequences, the enzyme binds to the DNA and cut each of the two strands of the double helix at specif c points in their sugar -phosphate backbones.

Insertional inactivation: It is a method in which recombinants and non-recombinants are differentiated from each other on the basis of their ability to produce colour in the presence of a chromogenic substrate. This method was developed as selection of recombinants due to inactivation of antibiotic gene is an inconvenient method in terms of simultaneous plating on two plates having different antibiotics.
OR
(A) Farm Land II.
Bt crop.
Because the use of pesticides is highly reduced for Bt crop // Decrease of pesticide used is also more significant for Bt crop.

(B) In Bt cotton a cry gene has been introduce from bacterium Bacillus thuringiensis (Bt) which causes synthesis of a toxic protein. This protein becomes active in the alkaline gut of bollworm feeding on cotton, punching holes in the lining causing death of the insect.

However; a Non-Bt crop will have no effect on the cotton bollworm/the yield of cotton will decrease/non-Bt will succumb to pest attack.

Related Theory
Bt cotton is created using the bacterium Bacillus thuringiensis as some strains of it produce proteins that kill certain insects such as lepidopterans (tobacco budworm, armyworm), coleopterans (beetles) and dipterans (flies, mosquitoes).

Protein crystals are formed by B. thuringiensis during a particular phase of their growth. A toxic insecticidal proteinis present in these crystals. The bacterium itself is not affected or killed by this toxin because the Bt toxin protein exist as inactive protoxins, but when an insect feed on such a plant and ingest the inactive toxin, the protoxin gets converted into an active form due to the alkaline pH of the gut, that solubilize the crystals.

Students can access the CBSE Sample Papers for Class 12 Economics with Solutions and marking scheme Term 2 Set 5 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Economics Term 2 Set 5 with Solutions

Time allowed: 2 Hours
Maximum Marks: 40

General Instructions:

• This is a Subjective Question Paper containing 13 questions.
• This paper contains 5 questions of 2 marks each, 5 questions of 3 marks each and 3 questions of 5 marks each.
• 2 marks questions are Short Answer Type Questions and are to be answered in 30-50 words.
• 3 marks questions are Short Answer Type Questions and are to be answered in 50-80 words.
• 5 marks questions are Long Answer Type Questions and are to be answered in 80-120 words.
• This question paper contains Case/Source Based Questions.

Question 1.
When is gross national product of an economy equal to gross national product?
OR
How is GDP at current prices converted into GDP at constant prices? (2)
Answer:
When net factor income from abroad is zero, gross national product of an economy is equal to gross national product.
OR
The following formula is used to covert GDP at current prices into GDP at constant prices:

GDP at constant prices \(=\frac{\text { GDP at current prices }}{\text { Current Price Index }} \times 100\)

Question 2.
Calculate equilibrium level of income:
(i) Autonomous consumption = ₹200
(ii) Marginal propensity to consume = 0.9
(iii) Investment expenditure = ₹1,000
OR
An economy is in equilibrium. Find Marginal Propensity to Consume from the following: National Income = ₹2,000
Autonomous Consumption = ₹400
Investment Expenditure = ₹200 (2)
Answer:
Y = C + l and C
= ₹200 + 0.9 Y
l = ₹1,000
Y = ₹200 + 0.9Y + ₹1,000
0.1Y = ₹1,200
Y = ₹12,000
OR
Given, Y = ₹2,000,
C = ₹400,
l = ₹200
We know, Y = C + b(Y) + l
₹2,000 = ₹400 + b(₹2,000) + ₹200
₹2,000 = ₹400 + ₹200 + b(₹2,000) ₹2,000 – ₹600 = b (₹2,000)
b = 1 400/2 000 = 0.7
b or MPC = 0.7

Question 3.
Value of which of the following can be greater than one and why?
(A) Marginal Propensity to Consume (MPC)
(B) Average Propensity to Consume (APC)
OR
Answer the following questions based on the figure given below:

At which level of income Average Propensity to Save (APS) will be equal to zero and why? (2)
Answer:
(A) Marginal Propensity to Consume (MPC) cannot be greater than one as it is percentage change in consumption when there is some change in the level of income which cannot be more than the change in income.

(b) The value of Average Propensity to Consume (APC) can be greater that one. This is because total consumption can be greater than total income, due to the existence of autonomous consumption.
OR
APS will be equal to zero at Point B as it indicates break-even level of income where Savings (S) are zero or Consumption(C) is equal to Income (Y).

Question 4.
State the names of six Indian Systems of Medicines (ISM) under AYUSH scheme of Government of India. (2)
Answer:
The six Indian Systems of Medicines (ISM) under AYUSH scheme of Government of India includes: Ayurveda, Yoga, Unani, Siddha, Naturopathy and Homeopathy.

Question 5.
‘Self-employed workforce is higher in rural areas.’ Justify the given statement with a valid argument. (2)
Answer:
Most of the rural people are mainly engaged in agriculture and do farming on their own plots thus, self-employed workforce is higher in rural areas.

Question 6.
All three countries India, China and Pakistan had started planning their development strategies in similar ways.” Explain.
OR
“Human development is more progressed in China than in India.” Explain. (3)
Answer:
While India announced its first Five Year Plan for 1951-56, Pakistan announced its first five-year plan, now called the Medium Term Development Plan, in 1956. China announced its First Five Year Plan in 1953. Since 2018, Pakistan is working on the basis of 12th Five Year Development Plan (2018-23), whereas, China is working on 14th Five Year Plan (2021-25). Until March 2017, India has been following Five Year Plan-based development model. India and Pakistan adopted similar strategies, such as creating a large public sector and raising public expenditure on social development. Till the 1980s, all the three countries had similar growth rates and per capita incomes.
OR
The process of Chinese economic reforms began in earnest and broadly during the 1980’s. At this point, India was in the middle of a slow growth process. At that time, poverty in rural China was reduced by 85% during the period from 1978 to 1989. In India, at the moment, it was reduced by only 50%. Moreover, the global exposure to China’s economy has become much wider than the Indian economy. Also, China’s overseas production has been the reason for significant growth. And India continues to be an inactive player in international markets.

Question 7.
Do you support the introduction of the one-child norm in India to control the population following the Chinese model? Give two arguments in support of your answer. (3)

Read the following case carefully and answer question number 8 and 9 given below:
Indian GDP may grow 9.2% this fiscal on base effect

India’s economy is expected to grow 9.2% in the current financial year, aided by the base effect of 7.3% contraction last year, according to the first advance estimates by the National Statistical Office (NSO) released on Friday.

The strong growth will lift: real gross domestic product (GDP) 1.3% over the pre-Covid levels ofFY20, but the underlying data showed consumer stress and weakness in the contact-intensive services sector. The estimated growth is below the Reserve Bank of India’s pre-third wave projection of 9.5% last month.

Most private economists had this week trimmed their growth forecast for the current fiscal following the surge in Covid cases.

The nominal gross domestic product (GDP) is forecast to rise 17.6% in the year against the budget estimate of 14.4% for the current year, underscoring high inflation. Gross value added (GVA) is projected to grow 8.6% compared with a contraction of 6.2% in FY21.
Economists see a downward bias to the growth estimates, as the data may not fully capture the impact of the ongoing third wave, a possibility acknowledged by the statistics office.

The estimates are likely to undergo revisions as more data become available, the statistics office said, adding that these are early estimates.

https://economictimes.indiatimes.com/news/economy/indicators/india-govt-forecasts-
year-to-march-economic-growth-of-9-2/articleshow/88758290.cms
Answer:
Arguments in support of the introduction of the one-child norm in India to control the population are:

• One-child norm will reduce the pressure of population growth of the country.
• One-child norm will solve the problem of food insufficiency in India.

Question 8.
“India’s economy is expected to grow 9.2% in the current financial year.”
Does the given statement mean that welfare of people of India increase at the same rate? (3)
Answer:
Generally, it is considered that an increase in the Gross Domestic Product (GDP) of any economy (India in this case) ensures an increase in the welfare of the people of the country. However, this may not always be correct. Some of the prime reasons for the same are:

• unequal distribution and composition of GDP,
• non-monetary transactions in the economy which are not accounted for in GDP, and
• occurrence of externalities in the economy (both positive and negative).

Question 9.
Explain the meaning of Real Gross Domestic Product and Nominal Gross Domestic Product. Real Gross Domestic Product is a better indicator of economic growth than Nominal Gross Domestic Product’. Do you agree with the given statement? (3)
Answer:
Nominal Gross Domestic Product (GDP) is measured as the product of current year output (Ql) of final goods and services and their current year price (PI). Real Gross Domestic Product (GDP), on the other hand, is measured as product of current year output (Ql) and their base year price (PO). Real GDP will increase if the output of goods and services produced in an economy is increasing.

Yes, the real GDP is a a better indicator of economic growth than Nominal GDP as the Real GDP is free from the influence of inflation or deflation in the economy during the time period.

Question 10.
“Infrastructure facilities raise productivity in tertiary sector of the economy.” Defend or refute the statement with valid argument. (3)
Answer:
The given statement is defended. Infrastructural facilities include rapid and efficient means of transport and communication. Such facilities are an essential components to enhance the productivity in the tertiary sector like education, banking, health, insurance etc. Some of these facilities have a direct impact on the production of goods and services while others give indirect support by building the social sector of the economy.

Question 11.
(A) Find national income. ₹ (In crores)
(i) Wages and salaries 1000
(ii) Net current transfers to abroad 20
(iii) Net factor income paid to abroad 10
(iv) Profit 400
(v) National debt interest 120
(vi) Social security contributions by employers 100
(vii) Rent 200
(viii) Interest 300
(ix) Royalty 50

(B) Gross Value Added at market price and Gross Domestic Product at market price are one and the same thing. State with valid reason, whether the statement is true or false.

OR

(A) Suppose in an imaginary economy GDP at Market Price in a particular fiscal year was ₹ 4,000 crores, National Income was ₹ 2,500 crores, Net Factor Income paid by the economy to Rest of the World was ₹ 400 crores and the value of Net Indirect Taxes is ₹ 450 crores. Estimate the value of consumption of fixed capital for the economy from the given data.
(B) Giving valid reasons, state why the ‘expenditure on providing police services by the government’ will be undertaken in estimation of National Income. (5)
Answer:
(A) National Income = Wages and Salaries + Social security contributions by employers + Rent + Royalty + Interest + Profit – Net factor income paid to abroad
= 1000 + 100 + 200 + 50 + 300 + 400 – 10 = ₹ 2040 crore

(B) The given statement is false as Gross Domestic Product is the result of sum of Gross Value Added by all the producing units/firms in an economy, during an accounting year.
OR
(A) NNPfc = GDPmp – Consumption of fixed capital – Net factor income to abroad – Net indirect taxes
2500 = 4000 – CFC -450 – 400
2500 = 3150 – CFC
CFC = ₹650 (in crores)

(B) Expenditure on providing police services by the government is a part of government’s final consumption expenditure thus should be included in the estimation of national income.

Question 12.
‘An economy is operating at under employment level of income’. What is meant by the given statement₹ Discuss one fiscal measure and one monetary measure to tackle the situation. (5)
Answer:
An economy is said to be operating at an under employment equilibrium level, if the planned aggregate expenditure falls short of available output in the economy, corresponding to the full employment level. It results into excess of output available over the anticipated aggregate demand at full employment level. To tackle such a situation the aggregate demand has to be increased up to the level that the stocks can be cleared.

Following measures may be taken for the same:
(i) Decrease in taxes: The government under its fiscal policy may decrease the rate of taxes (both direct and indirect taxes). This will ensure greater purchasing power in the hands of general public. This will help to increase aggregate demand and remove the deflationary gap.

(ii) Increase in money supply: Central bank through its expansionary monetary policy can increase the money supply in the economy. Central bank can use tools like bank rate, cash reserve ratio, repo and reverse repo rates etc. to ensure greater money in the hands of general public which would, in turn, increase the aggregate demand in the economy and be helpful in reducing/removing the deflationary gap.

Question 13.
(A) Why are less women found in regular salaried employment₹
(B) Analyse the recent trends in sectoral distribution of workforce in India:
Trends in Employment Pattern (Sectorwise), 1993 – 2012(in %)

Sector	1993­ 1994	1999­ 2000	2011­ 2012
Primary	64	60.4	24.3
Secondary	16	15.8	24.3
Services	20	23.8	26.8

Answer:
(A) Lesser women are found in regular salaried employment in India, because:

• jobs generally require skills and high level of literacy.
• lack of mobility among women in India due to social constraints.

(B) The given data indicates that over the given period, the proportion of workforce in primary sector has gone down from 64% in 1993-94 to 24.3% in 2011-12, this account to nearly a fall of 20% over the years. Whereas, the employment share of both secondary and the services sector has increased in India. The share of secondary sector has gone up by approximately 9% (from 16% in 1993-94 to 24% approximately in 2011-12), the corresponding figure for services sector has gone up by 7% (from 20% in 199394 to 27% approximately in 2011-12).

These sectoral changes have been very significant in the growth journey of India, showing the gradual shift of the workforce from primary sector to the secondary and tertiary sector.

Students can access the CBSE Sample Papers for Class 12 Geography with Solutions and marking scheme Term 2 Set 6 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Geography Term 2 Set 6 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 35
Roll No. ___________

General Instructions:

• Question paper is divided into 5 sections A, B, C, D & E
• In section A, question number 1 to 3 are Very Short Answer type questions. Attempt any 3 questions.
• In section B, question number 4 is Source based question.
• In section C, question number 5 & 6 are Short Answer type questions.
• In section D, question number 7 to 9 are Long Answer type questions.
• In section E, question number 10 is a Map based question.

Section – A
Very Short Answer Questions

Question 1.
Why is iron and steel industry also known as basic industry? (2)
Or
Secondary activities are concerned with manufacturing processing and construction (infrastructure) industries. What does the process of manufacturing entail?
Answer:
The iron and steel industry forms the base of all other industries and, therefore, it is called a basic industry. It provides raw material for other industries such as machine tools used for further production. It may also be called a heavy industry because it uses large quantities of bulky raw materials and its products are also heavy.
Or
Manufacturing involves a full array of production from handicrafts to moulding iron and steel and stamping out plastic toys to assembling delicate computer components or space vehicles. In each of these processes, the common characteristics are the application of power, mass production of identical products and specialised labour in factory settings for the production of standardised commodities. Manufacturing may be done with modern power and machinery or it may still be very primitive.

Question 2.
What role does climate play to attract tourists to a region? (2)
Answer:
Climate plays an important role to attract tourists to a region. Most people from colder regions expect to have warm, sunny weather for beach holidays. This is one of the main reasons for the importance of tourism in Southern Europe and the Mediterranean lands. People taking winter holidays have specific climatic requirements, either higher temperatures than their own homelands, or snow cover suitable for skiing.

Question 3.
State about network, node and link. (2)
Answer:
As transport systems develop, different places are linked together to form a network. Networks are made up of nodes and links. A node is the meeting point of two or more routes, a point of origin, a point of destination or any sizeable town along a route. Every road that joins two nodes is called a link. A developed network has many links, which means that places are well-connected.

Section – B
Source Based Question

Question 4.
Read the source given below and answer the following questions by choosing the correct option.
Rivers, canals, lakes and coastal areas have been important waterways since time immemorial Boats and steamers are used as means of transport for cargo and passengers. The development of inland waterways is dependent on the navigability width and depth of the channel, continuity in the water flow, and transport technology in use. Rivers are the only means of transport in dense forests. Very heavy cargo like coal, cement, timber and metallic ores can be transported through inland waterways.

In ancient times, riverways were the main highways of transportation as in India. But they lost importance because of competition from railways, lack of water due to diversion for irrigation, and their poor maintenance. The significance of rivers as inland waterways for domestic and international transport and trade has been recognised throughout the developed world.

Despite inherent limitations, many rivers have been modified to enhance their navigability by dredging, stabilising river banks, and building dams and barrages for regulating the flow of water. The following river waterways are some of the world’s important highways of commerce. The Rhine flows through Germany and the Netherlands.

It is navigable for 700 km from Rotterdam, at its mouth in the Netherlands to Basel in Switzerland. Ocean-going vessels can reach up to Cologne. The Ruhr River joins the Rhine from the east. It flows through a rich coalfield and the whole basin has become a prosperous manufacturing area. Dusseldorf is the Rhine port for this region.

i. What is the result of lack of navigable waters and development of other means of transport? (1)
Answer:
The lack of navigable waters and development of other means of transport is resulted in decrease in waterway transport.

ii. How can we improve water way navigability? (1)
Answer:
We can improve waterway navigability through desiltation by dredging, stabilising water banks and raising water level by damming.

iii. What is the navigable length of Volga waterway for transport? (1)
Answer:
The navigable length of Volga waterway for transport is 11,200 km.

Section – C
Short Answer Questions

Question 5.
Outline the distribution of petroleum resources in India. (3)
Or
What are Non-conventional energy sources ? How do ocean currents contribute to such kind of energy?
Answer:
Crude petroleum occurs in sedimentary rocks of the tertiary period. The distribution of petroleum resources in India is

• In Assam, Digboi, Naharkatiya and Moran are important oil producing areas.
• The major oilfields of Gujarat are Ankaleshwar, Kalol, Mehsana, Nawagam, Kosamba and Lunej.
• Mumbai High in Maharashtra which lies 160 km off Mumbai was discovered in 1973 and production commenced in 1976.
• Oil and natural gas have been found in exploratory wells in Krishna-Godavari and Kaveri basin on the East coast.

Or
Non-conventional energy sources refers to the renewable or non-exhaustible sources of energy. Conventional fuel sources, such as coal, petroleum, natural gas and nuclear energy use exhaustible raw materials. Non-conventional energy resources are the renewable and sustainable energy sources like solar, wind, hydrogeothermal and biomass.

These energy sources are more equitably distributed and environment-friendly. The energy sources will provide more sustained, eco-friendly cheaper energy after the initial cost is taken care of. Ocean currents are the store house of infinite energy. Tide and waves in the ocean comprises of potential, kinetic and thermal energy which can used to generate electricity.

Since, ocean currents are present globally and in inexhaustible amounts, they are also non-conventional energy sources, persistent efforts are being made to create a more efficient energy system from the ceaseless tidal waves and ocean current.

Question 6.
What does the Bharatmala scheme comprise of? (3)
Answer:
The Bharatmala is a proposed umbrella scheme which includes

• Development of State roads along coastal border areas, including connectivity of non-major ports.
• Backward areas, religious and tourist places for connectivity programme.
• Setubharatam Pariyojana, which is for the consruction of about 1500 major bridges and 200 rail over bridges rail under bridges.
• District Headquarters connectivity Scheme for the development of about 9000 km newly declared National Highways. The programme is targeted for completion by 2022.

Section – D
Long Answer Questions

Question 7.
Elucidate the concept of ‘trading’ in tertiary sector of economy. (5)
Or
Transport is an important tertiary activity. Explain.
Answer:
Trading is essentially buying and selling of items produced elsewhere and specifically intended for profit. The towns and cities where all these works take place are known us trading centres. The rise of trading from barter at the local level to money-exchange of international scale has produced many centres and institutions such as trading centres or collection and distribution points. They types of trading are

Retail Trading This is the business activity concerned with the sale of goods directly to the consumers. Most of the retail trading takes place in fixed establishments or stores solely devoted to selling. Street peddling, handcarts, trucks, door-to-door, mail-order, telephone, automatic vending machines and internet are examples of non-store retail trading.

Wholesale Trading It constitutes bulk business through numerous intermediary merchants and supply houses and not through retail stores. Some large stores including chain stores are able to buy directly from the manufacturers. However, most retail stores procure supplies from an intermediary source. Wholesalers often extend credit to retail stores to such an extent that the retailer operates very largely on the wholesaler’s capital.
Or
Transport is a tertiary activity which is essential for a nation’s economy. It is a service by which people, materials and manufactured goods are physically carried from one location to another. It is an organised industry created to satisfy the basic need of mobility. Speedy and efficient transport systems assist in the production, distribution and consumption of goods in the modern developing societies, the value of the material is significantly enhanced by transportation In other words, final sale price of an item depends on the total transportation involved from manufacturing to sale point.

Transport distance can be measured as: kilometre distance or actual distance of route length; time distance or the time taken to travel on a particular route; and cost distance or the expense of travelling on a route. In selecting the mode of transport, distance, in terms of time or cost, is the determining factor.

Factors affecting demand for transport is influenced by the size of population. The larger the population size, the greater is the demand for transport. Some of the commonly used form of transport are roadways, railways and airways. They can vary in distance covered, cost and goods or manpower transported. Railways are the cheapest option to carry large amount of cargo over large distances, whereas airways are the fastest but usually expensive compared to road and railways transport.

Question 8.
Coal is a commonly used conventional energy source. State its main uses and distribution in India. (5)
Answer:
Coal is a commonly used conventional energy source. It is an organic fossil fuel. It is an exhaustible source of energy. Its main uses are (i) Coal is used for generation of thermal power. (ii) Coal is used as an energy fuel and a reducing agent in iron smelting process. Coal is baked to produce coke which is a high energy source with minimal impurities. In India, coal is found in the rock sequences mainly of two geological ages, namely Gondwana and tertiary deposits. It distribution is

The most important Gondwana coal fields of India are located in Damodar Valley. The important coal fields in this region are Raniganj, Jharia, Bokaro, Giridih, Karanpura. Jharia is the largest coal field followed by Raniganj.

The most important coal mining centres are Singrauli in Madhya Pradesh (part of Singrauli coal field lies in Uttar Pradesh), Korba in Chhattisgarh, Talcher and Rampur in Odisha, Chanda-Wardha, Kamptee and Bander in Maharashtra and Singareni in Telangana and Pandur in Andhra Pradesh.

Tertiary coals occur in Assam, Arunachal Pradesh, Meghalaya and Nagaland. It is extracted from Darangiri, Cherrapunji, Mewlong and Langrin (Meghalaya); Makum, Jaipur and Nazira in upper Assam, Namchik – Namphuk (Arunachal Pradesh) and Kalakot (Jammu and Kashmir).

Question 9.
Nuclear energy is considered as an alternative and sustainable form of energy resource. How is nuclear energy generated and state its distribution in India? (5)
Answer:
Nuclear energy is considered as an alternative and sustainable form of energy resource. It is produced by generation of steam from heat generated during the fission process. Two important minerals used as raw materials for the generation of nuclear energy are uranium and thorium.

The steam is used to move turbines which produces electricity. The fission process results in splitting of atom into smaller atoms. The fission process takes place inside a reactor in a nuclear power plant. The fuel, uranium or thorium is placed at the core of the reactor. Nuclear energy is considered sustainable because it doesn’t burn fossil fuel and hence don’t produce greenhouse gases or any other pollutants. The distribution of uranium and thorium is

Geographically, uranium ores are known to occur in several locations along the Singhbhum Copper belt. It is also found in Udaipur, Alwar and Jhunjhunu districts of Rajasthan, Durg district of Chhattisgarh, Bhandara district of Maharashtra and Kullu district of Himachal Pradesh.

Thorium is mainly obtained from monazite and ilmenite in the beach sands along the coast of Kerala and Tamil Nadu. World’s richest monazite deposits occur in Palakkad and Kollam districts of Kerala, near Vishakhapatnam in Andhra Pradesh and Mahanadi river delta in Odisha.

Section – E
Map Based Question

Question 10.
On the political map of the world, identify the places (Attempt any 5). (1 × 5 = 5)
A. An inland waterway
B. A major airport
C. A major seaport
D. Western Terminal Station of Trans-Canadian Railway
E. An international airport
F. A canal

Answer: