CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions

Students can access the CBSE Sample Papers for Class 12 Biology with Solutions and marking scheme Term 2 Set 1 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Biology Standard Term 2 Set 1 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 40

General Instructions:

  • All questions are compulsory.
  • The question paper has three sections and 13 questions. All questions are compulsory.
  • Section-A has 6 questions of 2 marks each; Section-B has 6 questions of 3 marks each; and Section-C has a case-based question of 5 marks.
  • There is no overall choice. However, internal choices have been provided in some questions. A student has to attempt only one of the alternatives in such questions.
  • Wherever necessary, neat and properly labeled diagrams should be drawn.

SECTION – A
(Section A has 6 Questions of 2 marks each.)

Question 1.
Humans have innate immunity for protection against pathogens that may enter the gut along with food. What are the two barriers that protect the body from such pathogens? (2)
Answer:
Microbial pathogens enter the gut of humans along with food:

  • Physical barriers: Mucus coating of the epithelium lining the gastrointestinal tract helps in trapping microbes entering our body.
  • Physiological barriers: Acid in the stomach, saliva in the mouth prevent microbial growth.

Related Theory
The innate immune system is made of defense against infection which can be activated
immediately once a pathogen attacks. It is essentially made up of barriers that aim to keep viruses, bacteria, parasites, and other foreign particles out of our body or limit their ability to spread inside the body.
Caution
While answering, students should read properly that which type of barriers are asked, as in this question only gastrointestinal tract is involved, so only barriers related to it should be written in the answer.

CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions

Question 2.
A patient admitted in ICU was diagnosed to have suffered from myocardial infarction. The condition of coronary artery is depicted in the image below. Name two bioactive agents and their mode of action that can improve this condition.
CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions 1
Substantiate by giving two reasons as to why a holistic understanding of the flora and fauna in the cropland is required before introducing an appropriate biocontrol method. (2)
Answer:
Streptokinase (produced by the bacterium Streptococcus) is used as a ‘clot buster’ for removing dots from the blood vessels of patients who have undergone myocardial infarction.

Statins (produced by the yeast Monascus purpureus) acts by competitively inhibiting the enzyme responsible for synthesis of cholesterol and thus act as blood- cholesterol lowering agents.

Related Theory
Myocardial infarction is commonly known as a heart attack and is a deadly medical emergency, in which the heart muscle begins to die because it does not get enough blood flow due to a blockage in the arteries that supply blood to the heart. Blockage can be due to cholesterol deposition.
OR
Eradication of pests will disrupt predator- prey relationships, where beneficial predatory and parasitic insects which depend upon flora and fauna as food or hosts, may not be able to survive.

Holistic approach ensures that various life forms that inhabit the field, their life cycles, patterns of feeding and the habitats that they prefer are extensively studied and considered.

Related Theory
When biological methods are used for controlling plant diseases and pests it is termed as Biocontrol. The organic farmer is aware of the fact that eradication of pests is undesirable because in their absence the beneficiary predatory and parasitic insects that depend upon them as food or hosts will not be able to survive. Therefore, the use of biocontrol agents will greatly reduce our dependence on toxic and harmful chemicals and pesticides.

Question 3.
Identify the compound chemical structure is shown below. State any three of its physical properties. (2)
CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions 2
Answer:
It is Morphine.
Physically it appears as a white, odourless, crystalline compound.

Related Theory
Morphine acts as a depressant and slows down body functions. It is an effective sedative and a painkiller taken by patients who have undergone surgery.
It is generally consumed by snorting and injection.

CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions

Question 4.
Water samples were collected at points A, B and C in a segment of a river near a sugar factory and tested for BOD level. The BOD levels of samples A, B and C were 400 mg/L, 480 mg/L and 8 mg/L respectively. What is this indicative of? Explain why the BOD level gets reduced considerably at the collection point C? (2)
CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions 3
Answer:
At collection points A and B, the BOD level is high due to high organic pollution caused by sugar factory and sewage discharge.

At the collection point C, the water was released after secondary treatment/ biological treatment (where vigorous growth of useful aerobic microbes into floes consume the major part of the organic matter present in the river water or effluent due to sugar factory and sewage discharge).

Related Theory
The primary treatment is also known as physical treatment as it basically involves physical removal of small and large particles from the sewage with the help of techniques like filtration and sedimentation. The secondary treatment is also known as Biological Treatment because it involves the use of microbes for sewage treatment.

BOD can be defined as the amount of the oxygen that would be consumed if all the organic matter in one litre of water were oxidised by bacteria. The sewage water is treated till the BOD is reduced. Thus, indirectly, BOD is a measure of the organic matter present in the water. The greater the BOD of waste water, more is its polluting potential.

Question 5.
An ecologist study an area with population A, thriving on unlimited resources and showing exponential growth, introduced population B and C to the same area. What will be the effect on the growth pattern of the population A, B and C when living together in the same habitat? (2)

Answer:
This interaction will lead to competition between the individuals of population A,B and C for resources. Eventually the ‘fittest’ individuals will survive and reproduce.
The resources for growth will become finite and limiting, and population growth will become realistic.

Relcted Theory
Practically unlimited resources are not available to population of any species in order to permit exponential growth. Therefore, limited resources result in competition between individuals. A given habitat in nature, has enough resources to support a maximum possible number, beyond which no further growth is possible. This limit of nature is termed as nature’s carrying capacity (K) for that species in that habitat.

CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions

Question 6.
With the decline in the population of fig species it was noticed that the population of wasp species also started to decline. What is the relationship between the two and what could be the possible reason for decline of wasps?
OR
With the increase in the global temperature, the inhabitants of Antarctica are facing fluctuations in the temperature. Out of the regulators and the conformers, which of the two will have better chances of survival? Give two adaptations that support them to survive in the ambient environment? Give one suitable example. (2)
Answer:
The relationship between the plant and pollinator is called mutualism. Fig depends on wasp for pollination, and wasp depends on fig for food and shelter.
With the decline in population of figs, wasp loses its source of food and shelter.

Related Theory
In order to safe-guard the mutually beneficial system, plant-animal interactions involve co-evolution of the mutualists, i.e., the evolution of the flower and its pollinator species are tightly linked with one another. There is a tight relationship between species of fig trees and pollinator species of wasp. In this a particular fig species can be pollinated only by its ‘partner’ wasp species and no other species. The female wasp is benefltted by using the fruit as an oviposition (egg-laying) site and developing seeds within the fruit for nourishing its larvae. In return the wasp pollinates the fig inflorescence while searching for suitable egg-laying sites.

OR
Thermoregulation, Osmoregulation
Birds/mammals (any one)

Related Theory
w Conformers are the organisms which depends upon the changes in its external environment. Like aquatic animals change the osmotic concentration of the body fluids with that of the surrounding air, water osmotic concentration. They are also called as ectotherms as they depend on external sources of body heat since they cannot regulate their body temperature as per the variations in the external temperature. Examples: amphibians, reptiles,
fishes.

Regulators are the organisms that are capable of controlling their internal environment irrespective of their external surroundings to an extent. They are also called as endotherms as these animals depend on the internal heat generation for survival.

CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions

SECTION – B
(Section B has 6 Questions of 3 marks each.)

Question 7.
How do normal cells get transformed into cancerous neoplastic cells? Elaborate giving three examples of inducing agent.
OR
A person is suffering from a high grade fever. Which symptoms will help to identify if he/she is suffering from Typhoid, Pneumonia or Malaria? (3)
Answer:
Transformation of normal cells into cancerous neoplastic cells may be induced by following physical, chemical or biological agents causing DNA damage:

  • Ionising radiations like X-rays and gamma rays
  • Non-ionizing radiations like UV.
  • Chemical carcinogens present in tobacco smoke
  • Cellular oncogenes (c-onc) or protooncogenes, when activated under certain conditions cause cancer.

Viruses with oncogenes can transform normal cells to cancerous cells. (any 3)

Related Theory
The cell growth and differentiation in human body is a highly controlled and regulated process. But in cancerous cells, there is a breakdown of these regulatory mechanisms. The property by which normal cells differ from cancerous cells is contact inhibition by virtue of which contact with other cells inhibits their uncontrolled growth, whereas cancerous cells have lost this property. Therefore, the cancerous cells divide continuously to give rise to masses of cells called tumours or neoplasm.
OR
Answer:
If the person has sustained high fever (39° to 40°C), weakness, stomach pain, constipation, headache and loss of appetite, it is Typhoid.
If the person has fever, chills, cough and headache: and the lips and fingernails turn gray to bluish, it-is Pneumonia.
If the person has chills and high fever recurring every three to four days then, it is Malaria.

Related Theory
Typhoid: Bacterial infection caused by Salmonella typhi, which enter the small intestine through contaminated food and water and then migrate through blood to other organs.

Pneumonia: Bacterial disease caused by
Streptococcus pneumoniae and Haemophilus influenzae, which infects the alveoli of the lungs. The infection spreads to a healthy person by inhaling the droplets/aerosols that are released by an infected person.

Malaria is caused by Plasmodium (a tiny protozoan). The disease spreads from an infected individual to a healthy person through the vector female Anopheles mosquito. The malaria can become fatal if left untreated, by disrupting the blood supply to vital organs and thus may cause seizures, mental confusion, kidney failure, coma and even death.

CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions

Question 8.
Recognition of an antigenic protein of a pathogen or exposure to a pathogen occurs during many types of immune responses, including active immunity and induced active immunity. Specify the types of responses elicited when human beings get encountered by a pathogen. (3)
Answer:
When our body encounters an antigenic protein or a pathogen for the first time it produces a response which is of low intensity and our body retains memory of the first encounter.

  • The subsequent encounter with the same pathogen elicits a highly intensified response carried out with the help of two special types of lymphocytes present in our blood, B-lymphocytes, and T-lymphocytes.
  • The B-lymphocytes produce an army of proteins in response to these pathogens into our blood to fight with them. These proteins are called antibodies. The T-cells themselves do not secrete antibodies but help B-cells produce them.

Related Theory
Active Immunity: When an individual (host) is exposed to antigens in the form of living or dead microbes or other proteins. It results in the production of antibodies. This kind of immunity is slow and thus takes time to give its full effective response, but its effect is long lasting. It has no side effects.

The type of immune response produced by B-lymphocytes is termed as humoral immune response or antibody mediated immune response. The type of immune response produced by
T-lymphocytes is termed as Cell-mediated immune response or cell-mediated immunity (CMI).

Question 9.
In a pathological lab, a series of steps were undertaken for finding the gene of interest. Describe the steps, or make a flow chart showing the process of amplification of this gene of interest. (3)
Answer:
The flow chart shows the three steps involved in the process of PCR showing the following

  • Denaturation The DNA strands are treated with a temperature of 94°C (Heat) and the strands are separated. Each of the two separated DNA strands act as a template for the synthesis of a new strand.
  • AnneaLing The primers anneal to the complementary strands. This step is carried out at a slightly lower temperature of 40°C to 60°C.
  • Extension The DNA polymerase facilitates the extension of the strands by adding dNTPs (deoxy nucleoside Triphosphates) complementary to those of the template DNA. Taq DNA Polymerase also requires Mg2+ as a cofactor.

Diagram : Polymerase Chain Reaction
CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions 4

CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions

Question 10.
(A) ‘The Evil Quartet’ describes the rates of species extinction due to human activities. Explain how the population of organisms is affected by fragmentation the habitats.
(B) Introduction of alien species has led to environmental damage and decline of indigenous species. Give any one example of how it has affected the indigenous species?
(C) Could the extinction of Steller’s sea
cow and passenger pigeon be saved by man? Give reasons to support your answer. (3)
Answer:
(A) When a large habitat is broken into small fragments due to various activities, mammals and birds requiring large territories and certain animals with migratory habitats are badly affected, leading to population decline.

(B) Nile perch introduced in Lake Victoria eventually led to the extinction of an ecologically unique assemblage of more than 200 species of cichild fish.

  • Portheniumj Lantana/water hyacinth caused environmental damage and threat to our native species
  • African catfish-Clarias gariepinus introduced for aquaculture purposes is posing a threat to the indigenous catfishes in our rivers. (Any one)

(C) Yes; Humans have overexploited natural resources for their ‘greed’ rather than need’ leading to extinction of these animals. Sustainable harvesting could have prevented extinction of these species.

Related Theory
Examples of habitat loss:
(i) The tropical rain forests which were once covering more than 14 per cent of the earth’s land surface, now cover only about 6 per cent of the total area due to their fast destruction.
(ii) The Amazon rain forest, that are called the ‘lungs of the planet’, harbouring millions of species, is being cut and destroyed for cultivating soya beans or for conversion to grasslands for raising beef cattle.

Question 11.
(A) The image shown below is of a sacred grove found in India. Explain how has human involvement helped in the preservation of these biodiversity rich regions.
CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions 5
(B) Value of Z (regression coefficient) is considered for measuring the species richness of an area. If the value of Z is 0.7 for area A ,and 0.15 for area B, which area has higher species richness and a steeper slope? (3)
Answer:
(A) India’s history of religious and cultural traditions emphasized the protection of nature. In many cultures, tracts of forest are set aside, all the trees and wildlife within are venerated and given total protection. Sacred groves in many states are the last refuges for a large number of rare and threatened plants.

(B) Area A will have more species richness and a steeper slope.

Related Theory
w Sacred groves are found in Khasi and Jaintia Hills in Meghalaya, Aravalli Hills of Rajasthan, Western Ghat regions of Karnataka and Maharashtra and the Sarguja, Chanda and Bastar areas of Madhya Pradesh.

The species-area relationship is found out using the slope. Slope of regression or regression coefficient is used to measure species richness along an area. In smaller regions, an analysis of species-area relationship shows that the values of slope of regressionis the same irrespective of the taxonomic assemblage or the region. Whereas when analysis is carried out in large areas the slope of regression was found to be much steeper. Very large areas like the entire continents, the analysis of the species-area relationships will result in a slope that is much steeper i.e., the Z values are in the range of 0.6 to 1.2.

CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions

Question 12.
The image below depicts the result of gel electrophoresis
CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions 6
If the ladder represents sequence length upto 3000 base pairs (bp),
(A) Which of the bands (I – IV) correspond to 2500 bp and 100 bp respectively?
(B) Explain the basis of this kind of separation and also mention the significance of this process. (3)
Answer:
(A) Band III corresponds to 2500 base pairs, and Band IV corresponds to lOObp.

(B) The fragments will resolve according to their size. The shorter sequence fragments would move farthest from well as seen in Band IV (100 bp) which is lighter as compared to Band III which is heavier being 2500 base pairs.
The significance of electrophoresis is to purify the DNA fragments for use in constructing recombinant DNA by joining them with cloning vectors.

Related Theory
The basis of gel electrophoresis is that the DNA fragments separate according to their size through sieving effect provided by the agarose gel. Therefore, the smaller the fragment size, the farther it moves.
The purified DNA fragments (containing gene of interest) are used in constructing recombinant DNA by joining them with cloning vectors with the help of DNA ligase.

SECTION – C
(Section C has a case-based question of 5 marks.)

Question 13.
Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single stranded DNA. BamHl is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’ and cleaves these sequences just after the 5’- guanine on each strand.
(A) What is the objective of this action?

(B) Explain how the gene of interest is introduced into a vector.

(C) You are given the DNA shown below.
5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’
If this DNA was cut with BamHl, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.

(D) A gene M was introduced into E.coli cloning vector PBR322 at BamH 1 site. What will be its impact on the recombinant plamids? Give a possible way by which you could differentiate non recombinant to recombinant plasmids.
OR
GM crops especially Bt crops are known to have higher resistance to pest attacks. To substantiate this an experimental study was conducted in 4 different farmlands growing Bt and non Bt-Cotton crops. The farm lands had the same dimensions, fertility and were under similar climatic conditions. The histogram below shows the usage of pesticides on Bt crops and non-Bt crops in these farm lands.
CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions 7

(A) Which of the above 4 farm lands has successfully applied the concepts of Biotechnology to show better management practices and use of agrochemicals? If you had to cultivate, which crop would you prefer (Bt or Non- Bt) and why?

(B) Cotton Bollworms were introduced in another experimental study on the above farm lands wherein no pesticide was used. Explain what effect would a Bt and Non Bt crop have on the pest.
(5)
Answer:
(A) The two different DNA molecules will have compatible ends to recombine.

(B) Restriction enzyme cuts the DNA of the vector and then ligates the gene of interest into the DNA of the vector.

(C) 2 fragments
5’ ATTTTGAG 3’5’GATCCGTAATGTCCT 3’ 3′ TAAAACTCCTAG 5’.3’GCATTACAGGA 5′

CBSE Sample Papers for Class 12 Biology Term 2 Set 1 with Solutions

(D) BamHl site will affect tetracycline antibiotic resistance gene, hence the recombinant plasmids will lose tetracycline resistance due to inactivation of the resistance gene.
Recombinants can be selected from non recombinants by plating into a medium containing tetracycline, as the recombinants will not grow in the medium because the tetracycline resistance gene is cut.

Related Theory
Each restriction endonuclease acts by ‘inspecting’ the length of a DNA sequence. On finding its specific recognition sequence known as palindromic nucleotide sequences, the enzyme binds to the DNA and cut each of the two strands of the double helix at specif c points in their sugar -phosphate backbones.

Insertional inactivation: It is a method in which recombinants and non-recombinants are differentiated from each other on the basis of their ability to produce colour in the presence of a chromogenic substrate. This method was developed as selection of recombinants due to inactivation of antibiotic gene is an inconvenient method in terms of simultaneous plating on two plates having different antibiotics.
OR
(A) Farm Land II.
Bt crop.
Because the use of pesticides is highly reduced for Bt crop // Decrease of pesticide used is also more significant for Bt crop.

(B) In Bt cotton a cry gene has been introduce from bacterium Bacillus thuringiensis (Bt) which causes synthesis of a toxic protein. This protein becomes active in the alkaline gut of bollworm feeding on cotton, punching holes in the lining causing death of the insect.

However; a Non-Bt crop will have no effect on the cotton bollworm/the yield of cotton will decrease/non-Bt will succumb to pest attack.

Related Theory
Bt cotton is created using the bacterium Bacillus thuringiensis as some strains of it produce proteins that kill certain insects such as lepidopterans (tobacco budworm, armyworm), coleopterans (beetles) and dipterans (flies, mosquitoes).

Protein crystals are formed by B. thuringiensis during a particular phase of their growth. A toxic insecticidal proteinis present in these crystals. The bacterium itself is not affected or killed by this toxin because the Bt toxin protein exist as inactive protoxins, but when an insect feed on such a plant and ingest the inactive toxin, the protoxin gets converted into an active form due to the alkaline pH of the gut, that solubilize the crystals.

CBSE Sample Papers for Class 12 Economics Term 2 Set 5 with Solutions

Students can access the CBSE Sample Papers for Class 12 Economics with Solutions and marking scheme Term 2 Set 5 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Economics Term 2 Set 5 with Solutions

Time allowed: 2 Hours
Maximum Marks: 40

General Instructions:

  • This is a Subjective Question Paper containing 13 questions.
  • This paper contains 5 questions of 2 marks each, 5 questions of 3 marks each and 3 questions of 5 marks each.
  • 2 marks questions are Short Answer Type Questions and are to be answered in 30-50 words.
  • 3 marks questions are Short Answer Type Questions and are to be answered in 50-80 words.
  • 5 marks questions are Long Answer Type Questions and are to be answered in 80-120 words.
  • This question paper contains Case/Source Based Questions.

CBSE Sample Papers for Class 12 Economics Term 2 Set 5 with Solutions

Question 1.
When is gross national product of an economy equal to gross national product?
OR
How is GDP at current prices converted into GDP at constant prices? (2)
Answer:
When net factor income from abroad is zero, gross national product of an economy is equal to gross national product.
OR
The following formula is used to covert GDP at current prices into GDP at constant prices:

GDP at constant prices \(=\frac{\text { GDP at current prices }}{\text { Current Price Index }} \times 100\)

Question 2.
Calculate equilibrium level of income:
(i) Autonomous consumption = ₹200
(ii) Marginal propensity to consume = 0.9
(iii) Investment expenditure = ₹1,000
OR
An economy is in equilibrium. Find Marginal Propensity to Consume from the following: National Income = ₹2,000
Autonomous Consumption = ₹400
Investment Expenditure = ₹200 (2)
Answer:
Y = C + l and C
= ₹200 + 0.9 Y
l = ₹1,000
Y = ₹200 + 0.9Y + ₹1,000
0.1Y = ₹1,200
Y = ₹12,000
OR
Given, Y = ₹2,000,
C = ₹400,
l = ₹200
We know, Y = C + b(Y) + l
₹2,000 = ₹400 + b(₹2,000) + ₹200
₹2,000 = ₹400 + ₹200 + b(₹2,000) ₹2,000 – ₹600 = b (₹2,000)
b = 1 400/2 000 = 0.7
b or MPC = 0.7

CBSE Sample Papers for Class 12 Economics Term 2 Set 5 with Solutions

Question 3.
Value of which of the following can be greater than one and why?
(A) Marginal Propensity to Consume (MPC)
(B) Average Propensity to Consume (APC)
OR
Answer the following questions based on the figure given below:
CBSE Sample Papers for Class 12 Economics Term 2 Set 5 With Solutions 1
At which level of income Average Propensity to Save (APS) will be equal to zero and why? (2)
Answer:
(A) Marginal Propensity to Consume (MPC) cannot be greater than one as it is percentage change in consumption when there is some change in the level of income which cannot be more than the change in income.

(b) The value of Average Propensity to Consume (APC) can be greater that one. This is because total consumption can be greater than total income, due to the existence of autonomous consumption.
OR
APS will be equal to zero at Point B as it indicates break-even level of income where Savings (S) are zero or Consumption(C) is equal to Income (Y).

Question 4.
State the names of six Indian Systems of Medicines (ISM) under AYUSH scheme of Government of India. (2)
Answer:
The six Indian Systems of Medicines (ISM) under AYUSH scheme of Government of India includes: Ayurveda, Yoga, Unani, Siddha, Naturopathy and Homeopathy.

CBSE Sample Papers for Class 12 Economics Term 2 Set 5 with Solutions

Question 5.
‘Self-employed workforce is higher in rural areas.’ Justify the given statement with a valid argument. (2)
Answer:
Most of the rural people are mainly engaged in agriculture and do farming on their own plots thus, self-employed workforce is higher in rural areas.

Question 6.
All three countries India, China and Pakistan had started planning their development strategies in similar ways.” Explain.
OR
“Human development is more progressed in China than in India.” Explain. (3)
Answer:
While India announced its first Five Year Plan for 1951-56, Pakistan announced its first five-year plan, now called the Medium Term Development Plan, in 1956. China announced its First Five Year Plan in 1953. Since 2018, Pakistan is working on the basis of 12th Five Year Development Plan (2018-23), whereas, China is working on 14th Five Year Plan (2021-25). Until March 2017, India has been following Five Year Plan-based development model. India and Pakistan adopted similar strategies, such as creating a large public sector and raising public expenditure on social development. Till the 1980s, all the three countries had similar growth rates and per capita incomes.
OR
The process of Chinese economic reforms began in earnest and broadly during the 1980’s. At this point, India was in the middle of a slow growth process. At that time, poverty in rural China was reduced by 85% during the period from 1978 to 1989. In India, at the moment, it was reduced by only 50%. Moreover, the global exposure to China’s economy has become much wider than the Indian economy. Also, China’s overseas production has been the reason for significant growth. And India continues to be an inactive player in international markets.

CBSE Sample Papers for Class 12 Economics Term 2 Set 5 with Solutions

Question 7.
Do you support the introduction of the one-child norm in India to control the population following the Chinese model? Give two arguments in support of your answer. (3)

Read the following case carefully and answer question number 8 and 9 given below:
Indian GDP may grow 9.2% this fiscal on base effect

India’s economy is expected to grow 9.2% in the current financial year, aided by the base effect of 7.3% contraction last year, according to the first advance estimates by the National Statistical Office (NSO) released on Friday.

The strong growth will lift: real gross domestic product (GDP) 1.3% over the pre-Covid levels ofFY20, but the underlying data showed consumer stress and weakness in the contact-intensive services sector. The estimated growth is below the Reserve Bank of India’s pre-third wave projection of 9.5% last month.

Most private economists had this week trimmed their growth forecast for the current fiscal following the surge in Covid cases.

The nominal gross domestic product (GDP) is forecast to rise 17.6% in the year against the budget estimate of 14.4% for the current year, underscoring high inflation. Gross value added (GVA) is projected to grow 8.6% compared with a contraction of 6.2% in FY21.
Economists see a downward bias to the growth estimates, as the data may not fully capture the impact of the ongoing third wave, a possibility acknowledged by the statistics office.

The estimates are likely to undergo revisions as more data become available, the statistics office said, adding that these are early estimates.

CBSE Sample Papers for Class 12 Economics Term 2 Set 5 with Solutions

https://economictimes.indiatimes.com/news/economy/indicators/india-govt-forecasts-
year-to-march-economic-growth-of-9-2/articleshow/88758290.cms
Answer:
Arguments in support of the introduction of the one-child norm in India to control the population are:

  • One-child norm will reduce the pressure of population growth of the country.
  • One-child norm will solve the problem of food insufficiency in India.

Question 8.
“India’s economy is expected to grow 9.2% in the current financial year.”
Does the given statement mean that welfare of people of India increase at the same rate? (3)
Answer:
Generally, it is considered that an increase in the Gross Domestic Product (GDP) of any economy (India in this case) ensures an increase in the welfare of the people of the country. However, this may not always be correct. Some of the prime reasons for the same are:

  • unequal distribution and composition of GDP,
  • non-monetary transactions in the economy which are not accounted for in GDP, and
  • occurrence of externalities in the economy (both positive and negative).

CBSE Sample Papers for Class 12 Economics Term 2 Set 5 with Solutions

Question 9.
Explain the meaning of Real Gross Domestic Product and Nominal Gross Domestic Product. Real Gross Domestic Product is a better indicator of economic growth than Nominal Gross Domestic Product’. Do you agree with the given statement? (3)
Answer:
Nominal Gross Domestic Product (GDP) is measured as the product of current year output (Ql) of final goods and services and their current year price (PI). Real Gross Domestic Product (GDP), on the other hand, is measured as product of current year output (Ql) and their base year price (PO). Real GDP will increase if the output of goods and services produced in an economy is increasing.

Yes, the real GDP is a a better indicator of economic growth than Nominal GDP as the Real GDP is free from the influence of inflation or deflation in the economy during the time period.

Question 10.
“Infrastructure facilities raise productivity in tertiary sector of the economy.” Defend or refute the statement with valid argument. (3)
Answer:
The given statement is defended. Infrastructural facilities include rapid and efficient means of transport and communication. Such facilities are an essential components to enhance the productivity in the tertiary sector like education, banking, health, insurance etc. Some of these facilities have a direct impact on the production of goods and services while others give indirect support by building the social sector of the economy.

Question 11.
(A) Find national income. ₹ (In crores)
(i) Wages and salaries 1000
(ii) Net current transfers to abroad 20
(iii) Net factor income paid to abroad 10
(iv) Profit 400
(v) National debt interest 120
(vi) Social security contributions by employers 100
(vii) Rent 200
(viii) Interest 300
(ix) Royalty 50

(B) Gross Value Added at market price and Gross Domestic Product at market price are one and the same thing. State with valid reason, whether the statement is true or false.

CBSE Sample Papers for Class 12 Economics Term 2 Set 5 with Solutions

OR

(A) Suppose in an imaginary economy GDP at Market Price in a particular fiscal year was ₹ 4,000 crores, National Income was ₹ 2,500 crores, Net Factor Income paid by the economy to Rest of the World was ₹ 400 crores and the value of Net Indirect Taxes is ₹ 450 crores. Estimate the value of consumption of fixed capital for the economy from the given data.
(B) Giving valid reasons, state why the ‘expenditure on providing police services by the government’ will be undertaken in estimation of National Income. (5)
Answer:
(A) National Income = Wages and Salaries + Social security contributions by employers + Rent + Royalty + Interest + Profit – Net factor income paid to abroad
= 1000 + 100 + 200 + 50 + 300 + 400 – 10 = ₹ 2040 crore

(B) The given statement is false as Gross Domestic Product is the result of sum of Gross Value Added by all the producing units/firms in an economy, during an accounting year.
OR
(A) NNPfc = GDPmp – Consumption of fixed capital – Net factor income to abroad – Net indirect taxes
2500 = 4000 – CFC -450 – 400
2500 = 3150 – CFC
CFC = ₹650 (in crores)

(B) Expenditure on providing police services by the government is a part of government’s final consumption expenditure thus should be included in the estimation of national income.

CBSE Sample Papers for Class 12 Economics Term 2 Set 5 with Solutions

Question 12.
‘An economy is operating at under employment level of income’. What is meant by the given statement₹ Discuss one fiscal measure and one monetary measure to tackle the situation. (5)
Answer:
An economy is said to be operating at an under employment equilibrium level, if the planned aggregate expenditure falls short of available output in the economy, corresponding to the full employment level. It results into excess of output available over the anticipated aggregate demand at full employment level. To tackle such a situation the aggregate demand has to be increased up to the level that the stocks can be cleared.

Following measures may be taken for the same:
(i) Decrease in taxes: The government under its fiscal policy may decrease the rate of taxes (both direct and indirect taxes). This will ensure greater purchasing power in the hands of general public. This will help to increase aggregate demand and remove the deflationary gap.

(ii) Increase in money supply: Central bank through its expansionary monetary policy can increase the money supply in the economy. Central bank can use tools like bank rate, cash reserve ratio, repo and reverse repo rates etc. to ensure greater money in the hands of general public which would, in turn, increase the aggregate demand in the economy and be helpful in reducing/removing the deflationary gap.

CBSE Sample Papers for Class 12 Economics Term 2 Set 5 with Solutions

Question 13.
(A) Why are less women found in regular salaried employment₹
(B) Analyse the recent trends in sectoral distribution of workforce in India:
Trends in Employment Pattern (Sectorwise), 1993 – 2012(in %)

Sector 1993­ 1994 1999­ 2000 2011­ 2012
Primary 64 60.4 24.3
Secondary 16 15.8 24.3
Services 20 23.8 26.8

Answer:
(A) Lesser women are found in regular salaried employment in India, because:

  • jobs generally require skills and high level of literacy.
  • lack of mobility among women in India due to social constraints.

(B) The given data indicates that over the given period, the proportion of workforce in primary sector has gone down from 64% in 1993-94 to 24.3% in 2011-12, this account to nearly a fall of 20% over the years. Whereas, the employment share of both secondary and the services sector has increased in India. The share of secondary sector has gone up by approximately 9% (from 16% in 1993-94 to 24% approximately in 2011-12), the corresponding figure for services sector has gone up by 7% (from 20% in 199394 to 27% approximately in 2011-12).

CBSE Sample Papers for Class 12 Economics Term 2 Set 5 with Solutions

These sectoral changes have been very significant in the growth journey of India, showing the gradual shift of the workforce from primary sector to the secondary and tertiary sector.

CBSE Sample Papers for Class 12 Geography Term 2 Set 6 with Solutions

Students can access the CBSE Sample Papers for Class 12 Geography with Solutions and marking scheme Term 2 Set 6 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Geography Term 2 Set 6 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 35
Roll No. ___________

General Instructions:

  • Question paper is divided into 5 sections A, B, C, D & E
  • In section A, question number 1 to 3 are Very Short Answer type questions. Attempt any 3 questions.
  • In section B, question number 4 is Source based question.
  • In section C, question number 5 & 6 are Short Answer type questions.
  • In section D, question number 7 to 9 are Long Answer type questions.
  • In section E, question number 10 is a Map based question.

Section – A
Very Short Answer Questions

Question 1.
Why is iron and steel industry also known as basic industry? (2)
Or
Secondary activities are concerned with manufacturing processing and construction (infrastructure) industries. What does the process of manufacturing entail?
Answer:
The iron and steel industry forms the base of all other industries and, therefore, it is called a basic industry. It provides raw material for other industries such as machine tools used for further production. It may also be called a heavy industry because it uses large quantities of bulky raw materials and its products are also heavy.
Or
Manufacturing involves a full array of production from handicrafts to moulding iron and steel and stamping out plastic toys to assembling delicate computer components or space vehicles. In each of these processes, the common characteristics are the application of power, mass production of identical products and specialised labour in factory settings for the production of standardised commodities. Manufacturing may be done with modern power and machinery or it may still be very primitive.

CBSE Sample Papers for Class 12 Geography Term 2 Set 6 with Solutions

Question 2.
What role does climate play to attract tourists to a region? (2)
Answer:
Climate plays an important role to attract tourists to a region. Most people from colder regions expect to have warm, sunny weather for beach holidays. This is one of the main reasons for the importance of tourism in Southern Europe and the Mediterranean lands. People taking winter holidays have specific climatic requirements, either higher temperatures than their own homelands, or snow cover suitable for skiing.

Question 3.
State about network, node and link. (2)
Answer:
As transport systems develop, different places are linked together to form a network. Networks are made up of nodes and links. A node is the meeting point of two or more routes, a point of origin, a point of destination or any sizeable town along a route. Every road that joins two nodes is called a link. A developed network has many links, which means that places are well-connected.

Section – B
Source Based Question

Question 4.
Read the source given below and answer the following questions by choosing the correct option.
Rivers, canals, lakes and coastal areas have been important waterways since time immemorial Boats and steamers are used as means of transport for cargo and passengers. The development of inland waterways is dependent on the navigability width and depth of the channel, continuity in the water flow, and transport technology in use. Rivers are the only means of transport in dense forests. Very heavy cargo like coal, cement, timber and metallic ores can be transported through inland waterways.

In ancient times, riverways were the main highways of transportation as in India. But they lost importance because of competition from railways, lack of water due to diversion for irrigation, and their poor maintenance. The significance of rivers as inland waterways for domestic and international transport and trade has been recognised throughout the developed world.

Despite inherent limitations, many rivers have been modified to enhance their navigability by dredging, stabilising river banks, and building dams and barrages for regulating the flow of water. The following river waterways are some of the world’s important highways of commerce. The Rhine flows through Germany and the Netherlands.

It is navigable for 700 km from Rotterdam, at its mouth in the Netherlands to Basel in Switzerland. Ocean-going vessels can reach up to Cologne. The Ruhr River joins the Rhine from the east. It flows through a rich coalfield and the whole basin has become a prosperous manufacturing area. Dusseldorf is the Rhine port for this region.

i. What is the result of lack of navigable waters and development of other means of transport? (1)
Answer:
The lack of navigable waters and development of other means of transport is resulted in decrease in waterway transport.

ii. How can we improve water way navigability? (1)
Answer:
We can improve waterway navigability through desiltation by dredging, stabilising water banks and raising water level by damming.

iii. What is the navigable length of Volga waterway for transport? (1)
Answer:
The navigable length of Volga waterway for transport is 11,200 km.

CBSE Sample Papers for Class 12 Geography Term 2 Set 6 with Solutions

Section – C
Short Answer Questions

Question 5.
Outline the distribution of petroleum resources in India. (3)
Or
What are Non-conventional energy sources ? How do ocean currents contribute to such kind of energy?
Answer:
Crude petroleum occurs in sedimentary rocks of the tertiary period. The distribution of petroleum resources in India is

  • In Assam, Digboi, Naharkatiya and Moran are important oil producing areas.
  • The major oilfields of Gujarat are Ankaleshwar, Kalol, Mehsana, Nawagam, Kosamba and Lunej.
  • Mumbai High in Maharashtra which lies 160 km off Mumbai was discovered in 1973 and production commenced in 1976.
  • Oil and natural gas have been found in exploratory wells in Krishna-Godavari and Kaveri basin on the East coast.

Or
Non-conventional energy sources refers to the renewable or non-exhaustible sources of energy. Conventional fuel sources, such as coal, petroleum, natural gas and nuclear energy use exhaustible raw materials. Non-conventional energy resources are the renewable and sustainable energy sources like solar, wind, hydrogeothermal and biomass.

These energy sources are more equitably distributed and environment-friendly. The energy sources will provide more sustained, eco-friendly cheaper energy after the initial cost is taken care of. Ocean currents are the store house of infinite energy. Tide and waves in the ocean comprises of potential, kinetic and thermal energy which can used to generate electricity.

Since, ocean currents are present globally and in inexhaustible amounts, they are also non-conventional energy sources, persistent efforts are being made to create a more efficient energy system from the ceaseless tidal waves and ocean current.

CBSE Sample Papers for Class 12 Geography Term 2 Set 6 with Solutions

Question 6.
What does the Bharatmala scheme comprise of? (3)
Answer:
The Bharatmala is a proposed umbrella scheme which includes

  • Development of State roads along coastal border areas, including connectivity of non-major ports.
  • Backward areas, religious and tourist places for connectivity programme.
  • Setubharatam Pariyojana, which is for the consruction of about 1500 major bridges and 200 rail over bridges rail under bridges.
  • District Headquarters connectivity Scheme for the development of about 9000 km newly declared National Highways. The programme is targeted for completion by 2022.

Section – D
Long Answer Questions

Question 7.
Elucidate the concept of ‘trading’ in tertiary sector of economy. (5)
Or
Transport is an important tertiary activity. Explain.
Answer:
Trading is essentially buying and selling of items produced elsewhere and specifically intended for profit. The towns and cities where all these works take place are known us trading centres. The rise of trading from barter at the local level to money-exchange of international scale has produced many centres and institutions such as trading centres or collection and distribution points. They types of trading are

Retail Trading This is the business activity concerned with the sale of goods directly to the consumers. Most of the retail trading takes place in fixed establishments or stores solely devoted to selling. Street peddling, handcarts, trucks, door-to-door, mail-order, telephone, automatic vending machines and internet are examples of non-store retail trading.

Wholesale Trading It constitutes bulk business through numerous intermediary merchants and supply houses and not through retail stores. Some large stores including chain stores are able to buy directly from the manufacturers. However, most retail stores procure supplies from an intermediary source. Wholesalers often extend credit to retail stores to such an extent that the retailer operates very largely on the wholesaler’s capital.
Or
Transport is a tertiary activity which is essential for a nation’s economy. It is a service by which people, materials and manufactured goods are physically carried from one location to another. It is an organised industry created to satisfy the basic need of mobility. Speedy and efficient transport systems assist in the production, distribution and consumption of goods in the modern developing societies, the value of the material is significantly enhanced by transportation In other words, final sale price of an item depends on the total transportation involved from manufacturing to sale point.

Transport distance can be measured as: kilometre distance or actual distance of route length; time distance or the time taken to travel on a particular route; and cost distance or the expense of travelling on a route. In selecting the mode of transport, distance, in terms of time or cost, is the determining factor.

Factors affecting demand for transport is influenced by the size of population. The larger the population size, the greater is the demand for transport. Some of the commonly used form of transport are roadways, railways and airways. They can vary in distance covered, cost and goods or manpower transported. Railways are the cheapest option to carry large amount of cargo over large distances, whereas airways are the fastest but usually expensive compared to road and railways transport.

CBSE Sample Papers for Class 12 Geography Term 2 Set 6 with Solutions

Question 8.
Coal is a commonly used conventional energy source. State its main uses and distribution in India. (5)
Answer:
Coal is a commonly used conventional energy source. It is an organic fossil fuel. It is an exhaustible source of energy. Its main uses are (i) Coal is used for generation of thermal power. (ii) Coal is used as an energy fuel and a reducing agent in iron smelting process. Coal is baked to produce coke which is a high energy source with minimal impurities. In India, coal is found in the rock sequences mainly of two geological ages, namely Gondwana and tertiary deposits. It distribution is

The most important Gondwana coal fields of India are located in Damodar Valley. The important coal fields in this region are Raniganj, Jharia, Bokaro, Giridih, Karanpura. Jharia is the largest coal field followed by Raniganj.

The most important coal mining centres are Singrauli in Madhya Pradesh (part of Singrauli coal field lies in Uttar Pradesh), Korba in Chhattisgarh, Talcher and Rampur in Odisha, Chanda-Wardha, Kamptee and Bander in Maharashtra and Singareni in Telangana and Pandur in Andhra Pradesh.

Tertiary coals occur in Assam, Arunachal Pradesh, Meghalaya and Nagaland. It is extracted from Darangiri, Cherrapunji, Mewlong and Langrin (Meghalaya); Makum, Jaipur and Nazira in upper Assam, Namchik – Namphuk (Arunachal Pradesh) and Kalakot (Jammu and Kashmir).

CBSE Sample Papers for Class 12 Geography Term 2 Set 6 with Solutions

Question 9.
Nuclear energy is considered as an alternative and sustainable form of energy resource. How is nuclear energy generated and state its distribution in India? (5)
Answer:
Nuclear energy is considered as an alternative and sustainable form of energy resource. It is produced by generation of steam from heat generated during the fission process. Two important minerals used as raw materials for the generation of nuclear energy are uranium and thorium.

The steam is used to move turbines which produces electricity. The fission process results in splitting of atom into smaller atoms. The fission process takes place inside a reactor in a nuclear power plant. The fuel, uranium or thorium is placed at the core of the reactor. Nuclear energy is considered sustainable because it doesn’t burn fossil fuel and hence don’t produce greenhouse gases or any other pollutants. The distribution of uranium and thorium is

Geographically, uranium ores are known to occur in several locations along the Singhbhum Copper belt. It is also found in Udaipur, Alwar and Jhunjhunu districts of Rajasthan, Durg district of Chhattisgarh, Bhandara district of Maharashtra and Kullu district of Himachal Pradesh.

Thorium is mainly obtained from monazite and ilmenite in the beach sands along the coast of Kerala and Tamil Nadu. World’s richest monazite deposits occur in Palakkad and Kollam districts of Kerala, near Vishakhapatnam in Andhra Pradesh and Mahanadi river delta in Odisha.

Section – E
Map Based Question

Question 10.
On the political map of the world, identify the places (Attempt any 5). (1 × 5 = 5)
A. An inland waterway
B. A major airport
C. A major seaport
D. Western Terminal Station of Trans-Canadian Railway
E. An international airport
F. A canal
CBSE Sample Papers for Class 12 Geography Term 2 Set 6 with Solutions 1
Answer:
CBSE Sample Papers for Class 12 Geography Term 2 Set 6 with Solutions 2

CBSE Sample Papers for Class 12 Business Studies Term 2 Set 8 with Solutions

Students can access the CBSE Sample Papers for Class 12 Business Studies with Solutions and marking scheme Term 2 Set 8 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Business Studies Term 2 Set 8 with Solutions

Time allowed: 2 Hours
Maximum Marks: 40

General Instructions:

  • This is a Subjective Question Paper containing 12 questions.
  • This paper contains 4 questions of 2 marks each, 4 questions of 3 marks each and 4 questions of 5 marks each.
  • 2 marks questions are Short Answer Type Questions and are to be answered in 30-50 words.
  • 3 marks questions are Short Answer Type Questions and are to be answered in 50-80 words.
  • 5 marks questions are Long Answer Type Questions and are to be answered in 80-120 words.
  • This question paper contains Case/Source Based Questions.

Question 1.
Lailah Trends Ltd adopted several ways of training to improve the quality and quantity of output and provide job satisfaction
(A) Mr. Sameuls was asked to work with an expert for a specific time period so that he can learn by observations.
(B) Ms. Banerjee was provided study material so that she goes through these units by answering the questions and fill in the blanks.
Identify which techniques of training were used and for whom by Lailah Trends Ltd. (2)
Answer:
(A) The technique of training used for Mr.sameuls is coaching.
(B) The technique of training used for Ms. Banerjee is Programmed instructions.

CBSE Sample Papers for Class 12 Business Studies Term 2 Set 8 with Solutions

Question 2.
Name and explain the “on the job” method of training that is used to give training to plumber.(2)
Answer:
Apprenticeship training is given to plumber. Apprenticeship programmes put the trainee under the guidance of a master worker. These are designed to acquire a higher level of skill

Question 3.
Prakash Limited is a company manufacturing electrical goods. Mrs Renu is its managing director. By virtue of her wise direction, the company has achieved great heights. Management institute one day invited her for a lecture. There she got an opportunity to dialogue with the student of Management Studies. She narrated to them the story of her success. She told them two main things first employees should know that their work is being evaluated and progress reports prepared. Second, optimum use of human and physical resource should be made possible.
On the basis of the above case state any two points of importance of controlling function. (2)
Answer:
The two points that highlight the importance of the controlling function are as follows:
(1) Judging accuracy of standards: The controlling function helps the business managers to judge the objectivity and accuracy of the current standards. It also assists in reviewing and revising the standards keeping in view of the forthcoming changes in both the internal and external environment of the business.

(2) Improving employee motivation: The controlling function seeks to motivate the employees and helps them to give better performance. This is because it makes them aware well in advance about what they are expected to do and what the standards of performance are, on the basics of which they will be judged.

CBSE Sample Papers for Class 12 Business Studies Term 2 Set 8 with Solutions

Question 4.
‘Mission Coach Ltd.’ is a large and creditworthy company manufacturing coaches far Indian Railways. It now wants to export these coaches to other countries and decides to invest in new hi-tech machines. Since the investment is large, it requires long-term finance. It decides to raise funds by issuing equity shares. The issue of equity shares involves huge floatation cost. To meet the expenses of floatation cost, the company decides to tap the money market. Name and explain the money-market instrument the company can use far the above purpose.
Answer:
The company can us Commercial paper for the purpose. It is an instrument issued by large and credit worthy companies to raise short term funds at lower rates of interest than the market rates. It is an unsecured, negotiable promissory note with a fixed maturity period.

Question 5.
Gaspe Ltd. is a large manufacturing unit.
Recently, the company has conducted time and motion studies and concluded that on an average, a worker could produce 500 units per day. However it has been noticed that the average daily production of worker is in the range of 300-350 units. (3)
Answer:
The management function, in this case, is controlling which is a systematic process involving comparisons, measurement and evaluation of organisational goals. The step involved in the case is ‘Comparing actual performance with standards’ which means comparing the actual performance with the set standards.

The time and motion studies determined that the standards set were 500 units per day per worker but the average actual performance per worker is in the range of 300-350 units per day. Thus, the need for action = Desired performance – Actual performance = 500-300/350 units = 200/150 units. This means that the company produces 150-200 units less per day per worker.

CBSE Sample Papers for Class 12 Business Studies Term 2 Set 8 with Solutions

Based on the step of comparing results with standards, the next step the company under take will be’ Analysing Deviations’. This step is a study of determining the reasons for the variations of 150-200 units per day per worker from the set standards of 500 units per day per worker. The company will identify certain critical points in the production process that are important for timely completion of work.

The issues within the critical points of production processes are determined and analysed for understanding the nature of causes for deviations. If required, the management can control the issues by exception if the deviations are of urgent nature.

Following these analyses, the company will take the final step to take necessary action to correct problems or make improvements. These corrective actions attempt to increase the output of the workers by motivation and other incentives.

Question 6.
Sudershan Agro Ltd. wants to modernise its plants and machinery. To fulfill its capital requirements, the company decides to make a public issue of shares. Explain two different methods which the company may adopt for the new public issue of shares. (3)
Answer:
The market for the new issues of shares is known as primary market It deals with new securities being issued for the first time. The essential function of a primary market is to facilitate the transfer of investible funds from savers to entrepreneurs seeking to establish new enterprises or to expand existing ones through the issue securities for the first time. The various methods of floating new issues in the primary market are: (any two)

(1) Offer through prospectus: Offer through prospectus is the most popular method of raising funds by public companies in the primary market A prospectus makes a direct appeal to investors to raise capital, through an advertisement in newspapers and magazines.

(2) Offer for sale: Under this method, securities are not issued directly to the public but are offered for sale through intermediaries like issuing houses or stock brokers.

(3) Private placement: Private placement is the allotment of shares by a company to institutional investors or some selected individuals. It helps to raise capital more quickly than a public issue.

(4) Rights issue: This is a privilege given to existing shareholders to subscribe to a new issue of shares according to the terms and conditions of the company.

(5) E-IPOs: A company proposing to issue capital to the public through the online system of the stock exchange has to enter into an agreement with the stock exchange. This is called an Initial Public Offer (IPO).

CBSE Sample Papers for Class 12 Business Studies Term 2 Set 8 with Solutions

Question 7.
Name and explain the function of management which initiates actions. State any two points of importance of this function of management.(3)
Answer:
The process of acquiring human resources and physical assets and placing them under suitable roles and responsibilities should be directed towards achieving organisational goals. Directing or direction is the essence of all operations in an organisation that involves leading human and physical resources together through motivation, collaboration, coordination and delegation.

The points of importance of directing are: (any two)
(1) Initiates action: Direction initiates action based on the preconditions set under planning, organising and staffing. This implies that managers stimulate actions by supervising, motivating and leading their subordinates in the right way. Direction activates employees to work for achieving organisational goals.

(2) Integrates employees’ efforts: The work and activities of employees across all levels are interrelated and direction attempts to integrate all individual efforts. Individual efforts are integrated through coordination between plans, resources and human efforts and through guidance, supervision and counselling.

(3) Means of motivation: Organisational goals can be achieved by motivated employees who work willingly and perform to their best of their abilities. Directing helps in motivating employees to contribute their maximum efforts towards achieving organisational goals.

(4) Facilitates changes: Direction enables an organisation to adapt to changing conditions through better leadership and communication.

Question 8.
Identity and explain the elements of directing mentioned below.
(A) Astha, a manager, has the ability to influence others to bring about a change in their behaviour.
(B) Neeraj, a managing director, declares share in the profits to the manager for their contribution to increase profits of the company.
OR
State the steps in selection procedure, after the employment interview but before the job offer. (3)
Answer:
(A) Leadership: Leadership is the process of influencing the behaviour of people by making them strive voluntarily towards achievement of organisational goals. Leadership indicates the ability of an individual to maintain good interpersonal relations with followers and motivate them to contribute for achieving organisational objectives.

CBSE Sample Papers for Class 12 Business Studies Term 2 Set 8 with Solutions

(B) Motivation: Motivation means incitement or inducement to act or move. In the context of an organisation. It means the process of making subordinates to act in a desired manner to achieve certain organisational goals.

OR
The steps in selection procedure, after the employment interview but before the job offer are as follows:
Reference and Background Checks: Many employers request names, addresses, and telephone numbers of references for the purpose of verifying information and, gaining additional information on an applicant. Previous employers, known persons, teachers and university professors can act as references.

Selection Decision: The final decision has to be made from among the candidates who pass the tests, interviews and reference checks. The views of the concerned manager will be generally considered in the final selection because it is he/she who is responsible for the performance of the new employee.

Medical Examination: After the selection decision and before the job offer is made, the candidate is required to undergo a medical fitness test The job offer is given to the candidate being declared fit after the medical examination.

Question 9.
Which function of management helps in obtaining right people and putting them on the right jobs. Explain four points of importance of this function.
OR
Veronica Ltd. is a large manufacturing unit. Recently, the company has conducted time and motion studies and concluded that on an average, a worker could produce 500 units per day. However it has been noticed that the average daily production of worker is in the range of 300-350 units.
(a) Name the function of management and identify the step in the process of this function which helped in finding out that the actual production of a worker is less than the set target.
(b) To complete the process of the function identified in question (a) and to ensure the performance as per time and motion studies, explain what further steps a manager has to take? (5)
Answer:
The function of management which helps in obtaining right people and putting them on the right jobs is staffing. Staffing is “putting people to jobs’. It begins with workforce planning and includes different other function like recruitment, selection, training, development, promotion, compensation and performance appraisal of workforce.

CBSE Sample Papers for Class 12 Business Studies Term 2 Set 8 with Solutions

In other words, staffing is that part of the process of management which is concerned with obtaining, utilising and maintaining a satisfactory and satisfied work force.

Proper staffing ensures the following benefits to the organisation: (any four)

  • It helps in discovering and obtaining competent personnel for various jobs;
  • It Makes for higher performance, by putting right person on the right job;
  • It ensures the continuous survival and growth of the enterprise through the succession planning for managers;
  • It helps to ensure optimum utilisation of the human resources. By avoiding overmanning, it prevents under -utilisation of personnel and high labour costs. At the same time it avoids disruption of work by indicating in advance the shortages of personnel; and
  • It improves job satisfaction and morale of employees through objective assessment and fair reward for their contribution.

OR
(a) The management function, in this case, is controlling which is a systematic process involving comparisons, measurement and evaluation of organisational goals. The step involved in the case is ‘Comparing actual performance with standards’ which means comparing the actual performance with the set standards.

CBSE Sample Papers for Class 12 Business Studies Term 2 Set 8 with Solutions

The time and motion studies determined that the standards set were 500 units per day per worker but the average actual performance per worker is in the range of 300-350 units per day.

Thus, the need for action = Desired performance – Actual performance = 500-300/350 units = 200/150 units. This means that the company produces 150-200 units less per day per worker.

(b) Based on the step of comparing results with standards, the next step the company undertake will be ‘ Analysing Deviations’. This step is a study of determining the reasons for the variations of 150-200 units per day per worker from the set standards of 500 units per day per worker. The company will identify certain critical points in the production process that are important for timely completion of work. The issues within the critical points of production processes are determined and analysed for understanding the nature of causes for deviations. If required, the management can control the issues by exception if the deviations are of urgent nature. Following these analyses, the company will take the final step to take necessary action to correct problems or make improvements. These corrective actions attempt to increase the output of the workers by motivation and other incentives.

CBSE Sample Papers for Class 12 Business Studies Term 2 Set 8 with Solutions

Question 10.
State the steps which are involved in the screen-based trading for buying and selling of securities in the secondary market. (5)
Answer:
The following are the first four steps in the screen based trading for buying and selling of securities in the secondary market:
(1) The investor has to approach a registered broker or sub-broker and sign a broker client agreement and a client registration form before placing an order to buy or sell securities

(2) The investor has to open a “demat” account or “beneficial owner” account with a depository participant for holding and transferring securities in the demat form.

(3) The investor then places an order with the broker to buy or sell shares, the broker will go ahead with the deal and issue the order confirmation slip to the investor.

(4) The broker then will go on-line and connect to the main stock exchange and match the share and best price available.

Question 11.
Raghav Agro Ltd. has started manufacturing biocompost useful for organic farming and has set up a unit at Nasik. Due to increasing demand of organic forming in the country, the company is unable to meet the demands of the market. It is planning to set up a second unit at Kolhapur. The finance manager estimates that it will require rs.150 crores for the set-up and rs. 25 crores for working capital to start the second unit. As a highly capital intensive industry, what factors will affect the fixed and working capital? (5)
Answer:
The factors that affect requirements of fixed and working capital in a company include:

(1) Growth prospects: As Raghav Agro Ltd.’s products made by biocompost will have high demand, Raghav Agro Ltd. will have higher growth prospects and will require working capital in the short-run and fixed capital in the long-run.

(2) Scale of operation: Biocompost production is highly capital intensive and will require huge amount of fixed capital.

(3) Availability of raw material: Raw materials required are yard wastes which are not expensive but are not easily available. Accordingly, working capital will be high as Raghav Agro Ltd. will have large inventories for a specific time period to cater to the demand.

(4) Nature of business: Raghav Agro Ltd.’s biocompost production unit is highly capital intensive and will take more time to convert inventory of raw materials into finished goods. Thus, the fixed and working capital requirements of Raghav Agro Ltd. will be high.

CBSE Sample Papers for Class 12 Business Studies Term 2 Set 8 with Solutions

Question 12.
“Any person who buys any goods for a consideration is called a consumer.” What are the different ways in which a ‘consumer’ is defined as per the provisions of Consumer Protection Act, 1986?
OR
Mr Rohan purchased a new motorbike for rupees 2 lakh and his friends Mr Hamir purchased a new car for rupees 25 lakh. After a few days it was found that motorbike and car both were defective. They are thinking to whom they should complain about it. Suggest them the solution to their problem.
Answer:
Under the Consumer Protection Act,1986 a consumer is defined as:

(1) Any person who buys any goods for a consideration, which has been paid or promised, or partly paid and partly promised, or under any scheme of deferred payment It includes any user of such goods, when such use is made with the approval of the buyer, but does not include a person who obtains goods for re-sale or any commercial purpose.

(2) Any person who hires or avails of any service, for a consideration which has been paid or promised, or partly paid and partly promised, or under any system of deferred payment. It includes any beneficiary of services when such services are availed of with the approval of the person concerned, but does not include a person who avails of such services for any commercial purpose.

Rohan should file his complaint with district forum. A complaint can to be made to the appropriate District Forum when the value of the goods or services in question, along with the compensation claimed, does not exceed ₹20 lakhs.

CBSE Sample Papers for Class 12 Business Studies Term 2 Set 8 with Solutions

In case the aggrieved party is not satisfied with the order of the District Forum, he can appeal before the State Commission within 30 days of the passing of the order. Hamir should file his complaint with state forum. A complaint can to be made to the appropriate State Commission when the value of the goods or services in question, along with the compensation claimed, exceeds ₹20 lakhs but does not exceed ₹1 crore. The appeals against the orders of a District Forum can also be filed before the State Commission.

CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions

Students can access the CBSE Sample Papers for Class 12 Physics with Solutions and marking scheme Term 2 Set 5 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Physics Standard Term 2 Set 5 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 40

General Instructions:

  • There are 12 questions in all. All questions are compulsory.
  • This question paper has three sections: Section A, Section B and Section C.
  • Section A contains three questions of two marks each, Section B contains eight questions of three marks each, Section C contains one case study-based question of five marks.
  • There is no overall choice. However, an internal choice has been provided in one question of two marks and two questions of three marks. You have to attempt only one of the chokes in such questions.
  • You may use log tables if necessary but use of calculator is not allowed.

SECTION – A
(Section A contains 3 questions of 2 marks each.)

Question 1.
Explain the formation of secondary rainbow. (2)
Answer:
It is the result of fur-step process. Refraction with dispersion followed by internal reflection, and finally reflection.
CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions 1
It is found that red light emerges at an angle of 50° related to the incoming sunlight and violet light emerges at an angle of 53°. Thus, the observer sees secondary rainbow with violet colour on top and red colour on the bottom. The intensity of light is reduced at second internal reflection and hence it is fainter than primary rainbow.

CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions

Question 2.
What is the shape of fringe pattern on the screen? (2)
Answer:
The locus of point P in the plane of the screen, such that S2P-SiP is a constant, is a hyperbola. Thus, fringe pattern are hyperbola.
CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions 2

Question 3.
A parallel beam of light of 450 nm falls on a narrow slit and the resulting diffraction pattern is observed on a screen 1.5 m away. It is observed that the first minimum is at a distance of 3 mm from the centre of the screen. Calculate the width of the slit.
OR
Draw the diagram of a solar cell and draw its V-l characteristics. (2)
Answer:
The distance of the nth minimum from the centre of the screen,
Xn = \(\frac{n \mathrm{D} \lambda}{a}\)
Where, D → distance of slit from
screen
λ → wavelength of the light
a → width of the slit
For first minimum,
n = 1,
Xn = 3 × 10-3 m
D = 1.5 m
λ = 450 × 10-9m
3 × 10-3 = \(\frac{1 \times(1.5) \times\left(450 \times 10^{-9}\right)}{a} \frac{n D \lambda}{a}\)
a = \(\frac{1 \times(1.5) \times\left(450 \times 10^{-9}\right)}{3 \times 10^{-3}}\)
a = 0.255 mm
OR
CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions 3

Caution
V-I characteristics of solar cell is drawn in fourth quadrant of the coordinate axes, This is because a solar cell does not draw current but supplies the same to the load.

CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions

SECTION – B
(Section B consists of 8 questions of 3 marks each.)

Question 4.
The trajectories, traced by different a-particles, in Geiger Marsden experiment were observed as shown in the figure.
CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions 4
(A) What names are given to the symbols ‘b’ and ‘θ’ shown here.
(B) What can we say about the values of b for
(i) θ = 0°
(ii) θ = π radians. (3)
Answer:
(A) The smbo1b’ represents impact parameter and ‘θ’ represents the scattering angle.
(B) (i) When θ = 0o. the impact parameter will be maximum and represent the atomic size.

(ii) When θ = π radians, the impact parameter ‘b’ will be minimum and represent the nuclear size.

Question 5.
Draw reflected or refracted wavefront when a plane wavefront is incident on prism, convex lens and concave mirror.
OR
What difference between an intrinsic semiconductor and p-type extrinsic semiconductor? Why p-type semiconductor is electrically neutral even if number of holes are larger than the number of electrons? (3)
Answer:
(A) (i) When a plane wave is incident on prism
CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions 5
(ii) Convex lens
CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions 6
(iii) Concave mirror
CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions 7
OR

Intrinsic Semiconductors p-Type Extrinsic Semiconductor
These pure semiconducting materials and known variety is added to them. They have equal number of holes and electrons. These are prepared by doping a small quantity of impurity of trivalent material to the pure semiconductor material which results in higher number of holes compared to electrons.
The electrical conductivity is generally small. The electrical conductivity is comparatively very high.

A p-type semiconductor crystal is electrically neutral because the charge of additional charge carriers is just equal and opposite to that of the ionized cores in the crystal lattice.

CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions

Question 6.
(A) Monochromatic light of frequency 6.0 × 1014 Hz is produced by a laser. The power emitted is 2.0 × 10-3 W. Estimate the number of photons emitted per second on an average by the source.

(B) Draw a plot showing the variation of photoelectric current versus the intensity of incident radiation on a given photosensitive surface. (3)
Answer:
(A) The energy of a photon of frequency v is
E = hv
= (6.63 × 10-34 Js) × (6 × 1014 s-1)
= 3.98 × 10-19 J = 4 × 10-19J

If n be the number of photons emitted by the source per second, then the power P transmitted in the beam is given by,
P = nE
∴ n = \(\frac{P}{E}\)
⇒ n = \(\frac{2 \times 10^{-3}}{4 \times 10^{-19}}\)
5 × 1015 photons/sec

Related Theory
Photoelectric current is directly proportional to the intensity of incident radiation.

Question 7.
The oscillating magnetic field in a plane electromagnetic wave is given by:
By = (8 × 10-6) sin[2 × 1011t + 300π X]T
(A) Calculate the wavelength of the electromagnetic wave.
(B) Write down the expression for the oscillating electric field. (3)
Answer:
(A) Comparing above equation by the standard equation of magnetic field is:
By = B0 sin(ωt + kx)T
We get B0 = 8 × 10-6 T,
ω = 2 × 1011 rad/s,
k = \(\frac{2 \pi}{\lambda}\) = 300π
Wavelength
λ = \(\frac{2 \pi}{300 \pi}\)
= \(\frac{1}{150}\) m = 6.67 mm

(B) E0 = B0C
= 8 × 10-6 × 3 × 108
= 2.4 × 103V/m.
According to right hand system of vector E, vector B, vector K, the electric field oscillates along negative Z-axis, so equation is
Ez = -2.4 × 103sin(2 × 1011t + 300π X)\(\frac{\mathrm{V}}{\mathrm{m}}\)

CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions

Question 8.
(A) Write the relationship between angle of incidence ‘F, angle of prism ‘A’ and angle of minimum deviations δm for a triangular prism.

(B) A ray of light suffers minimum deviation, while passing through a prism of refractive index 1.5 and refracting angle 60°. Calculate the angle of deviation and angle of incidence. (3)
Answer:
(A) The relation between the angle of incidence i, angle of prism A, and the angle of minimum deviation δm, for a triangular prism is given by
i = \(\frac{\left(A+\delta_{m}\right)}{2}\)

(B) Here,
μ = 1.5,
A = 60°,
δm = ?
In the position of minimum deviation
I = \(\frac{A+\delta_{m}}{2}\),
r = \(\frac{\mathrm{A}}{2}\)
As
μ = \(\frac{\sin i}{\sin r}\)
∴ 1.5 = \(\frac{\sin i}{\sin 30^{\circ}}\)
⇒ sin i = 1.5 × 0.5
= 0.75
⇒ i = sin-1 (0.75)
= 48.60°
δm = 2i – A
= 2 × 48.6 – 60 = 37.2°

CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions

Question 9.
(A) In a nuclear reaction
\({ }_{2}^{3} \mathrm{He}\) + \({ }_{2}^{3} \mathrm{He}\) → \({ }_{2}^{4} \mathrm{He}\) + \({ }_{1}^{1} \mathrm{He}\) + \({ }_{1}^{1} \mathrm{He}\) + 12.86 MeV though the number of nucleons is conserved on both sides of the reaction, yet the energy is released. How ? Explain. (B) Draw a plot of potential energy between a pair of nucleoni as a function of their separation. Mark the regions where
potential energy is
(i) positive and
(ii) negative. (3)
Answer:
(A) in a nuclear reaction, the sum of the masses of the target nucleus \({ }_{2}^{3} \mathrm{He}\) may be greater or less then sum of the masses of the product nucleus \({ }_{2}^{4} \mathrm{He}\) and the \({ }_{1}^{1} \mathrm{He} .\) So from the law of conservation of mass energy, some energy, (12.86 MeV) is evolved in nuclear reaction. This energy is called Q-value of the nuclear reaction. The binding energy of the nucleus on the left side is not equal to the right side. The difference in the binding energies on two sides appears as energy released or absorbed in the nuclear reaction.

(B) The potential energy is minimum at to- For distance larger than r0 the negative potential energy goes on decreasing and for the distances Less than r0 the negative potential energy decrease to zero and then becomes positive and increases abruptly. Thus, A to B is the positive potential energy region and B to C is the negative potential energy region.
CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions 8

Question 10.
(A) Give the significance of the sentence “a light ray, while undergoing refraction at the interface of two media, bends towards the normal in the second media”.

(B) Diameter of a plano-convex lens is 6 cm and thickness at the centre is 3 mm. If speed of light in material of lens is 2 × 108 m/s. Find the focal length of the lens? (3)
Answer:
(A) The second medium is optically denser with respect to first medium and speed of Light in second medium is less.
(B)
CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions 9
n = \(\frac{3}{2}\) [∵ n = \(\frac{C}{V}\)]
32 + (R – 3 mm)2 = R2
⇒ 32 + R2 – 2R (3 mm) + (3 mm)2 = R2
⇒ R ≈ 15 cm
CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions 10
⇒ f = 30 cm

Caution
Students are often confused to find the value ofR. In this question they have to use Pythagoras theorem.

CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions

Question 11.
The ground state energy of hydrogen atom is -13.6 eV. If an electron makes a transition from an energy level -0.85 eV to -1.51 eV, calculate the wavelength of the spectral line emitted. To which series of hydrogen spectrum does this wavelength belong?
OR
Give reasons for the following:
(A) Why semiconductor diodes are preferred over vacuum diodes?
(B) A photodiode, when used as a detector of optical signals is operated under reverse bias.
(C) The band gap of the semiconductor used for fabrication of visible LEDs must be at least 1.8 eV. (3)
Answer:
As we know, En = \(\frac{-13.6}{n^{2}}\)eV …………. (i)
For n = 1, E1 = – 13.6 eV
When electron undergoes transition from EA = – 0.85 eV Then, from equation (i),
– 0.85 = – \(\frac{13.6}{n_{A}^{2}}\) ⇒ nA = 4
Similarly, -1.51 = \(\frac{-13.6}{n_{B}^{2}}\) ⇒ nB

Hence, electron transits from n = 4 to n = 3 which corresponds to Paschen series of hydrogen atom.
As, \(\frac{1}{\lambda}\) = R(\(\frac{1}{n_{B}^{2}}-\frac{1}{n_{A}^{2}}\))
Here nA = 4, nB = 3, R = 1.0974 × 107
Then \(\frac{1}{\lambda}\) = 1.097 × 107(\(\frac{1}{3^{2}}-\frac{1}{4^{2}}\))m-1
⇒ λ = 1875 nm
OR
(A) In semiconductor diodes, no cathode heating is required in junction diode for production of charge carriers. Voltage drop across a junction diode is much less compared to that across a vacuum diode. Semiconductor diodes can be used for much higher frequencies.

(B) When operated under reverse bias, the photodiode can detect changes in current with changes in light intensity more easily because the fractional change in minority charge carriers is more than that in majority charge carriers.

(C) The Photon energy, visible light photons vary from about 1.8 eV to 3 eV. Hence for visible LEDs, the semiconductor must have a band gap of 1.8 eV.

CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions

SECTION – C
(Section C consists one case study-based question of 5 marks.)

Question 12.
Wave theory of light was followed while explanation of photoelectric effect. There were many failures of wave theory of light. According to wave theory when light incident on a surface, energy is distributed continuously over the surface. So that electron must take a time interval to accumulate suffiicient energy to come out. But in experiment there is no time lag. When intensity is increased, more energetic electrons should be emitted. So that stopping potential should be intensity dependent. But it is not observed. According to wave theory, if intensity is suffiicient then, at each frequency, electron emission is possible. It means there should not be existence of threshold frequency.
CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions 11
(A) The stopping potential necessary to reduce the photoelectric current of zero:
(i) is directly proportional to wavelength of incident light.
(ii) uniformly increases with the wavelength of incident light.
(iii) directly proportional to frequency of incident light.
(iv) uniformly increases with the frequency of incident light.

(B) The photoelectric threshold frequency of a material is u. When light of frequency 4 u is incident on the metal, the maximum kinetic energy of the emitted photoelectron is:
(i) \(\frac{5}{2}\)hu
(ii) 3 hu
(iii) 4 hu
(iv) 5 hu

(C) When photons of energy hv fall on an aluminium plate (of work function Eo), photoelectrons of maximum kinetic energy K are ejected. If the frequency of radiation is doubled, the maximum kinetic energy of the ejected photoelectrons will be:
(i) K + hv
(ii) K + E0
(iii) 2K
(iv) K

(D) To understand photoelectric effect a graph is plotted between two factors, which is a straight line. The factors are:
(i) Intensity of radiation and photoelectric current
(ii) Potential of anode and photoelectric current
(iii) Threshold frequency and velocity of photoelectrons
(iv) Intensity of radiation and stopping potential.

(E) Light of wavelength 5000 Å falls on a sensitive plate with photoelectric work function 1.9 eV. The maximum kinetic energy of the photoelectrons emitted will be:
(i) 0.58 eV
(ii) 2.48 eV
(iii) 1.24 eV
(iv) 1.16 eV (5)
Answer:
(A) (d) uniformly increases with the frequency of incident light
Explanation: The negative potential at which photoelectric current becomes zero is called stopping potential.
By eVs = hv – Φ
Stopping potential required to reduce the photoelectric current to zero “decreases uniformly with the frequency of the incident radiation”.

(B) (b) 3hu
Explanation: The maximum kinetic energy of the emitted electrons is given by Kmax = hu-Φ0
= h(4u) – h(u) = 3hu

Related Theory
Maximum kinetic energy of the emitted electron = hv – Φ0
(C) (a) K + hv
Explanation: Let K and K’ be the maximum kinetic energy of photoelectrons for incident light of frequency v and 2v respectively. According to Einstein’s photoelectric equation,
K = hv – E0 ………….. (i)
and K’ = h(2v) – E00 ………….. (ii)
= 2hv – E0 = hv + hv – E0
K’ = hv + K [using (i)]

CBSE Sample Papers for Class 12 Physics Term 2 Set 5 with Solutions

Related Theory
The kinetic energy of the emitted electrons is given by K= hv – Φ0

(D) (a) Intensity of radiation and photoelectric current
Explanation: Intensity of radiation linearly changes the photoelectriccurrent. Photoelectric current ∝ intensity of radiation.

Caution
Students are often confused about the relation between photoelectric current and intensity of radiation. They are directly proportional to each other.
(E) (a) 0.58 eV
Explanation: hv = \(\frac{h c}{\lambda}\)
= \(\frac{1240}{500}\)
= 2.48 eV
\(\frac{1}{2}\) mvmax2 = hv – Φ0 = 2.48 – 1.90
= 0.58 eV

Related Theory
Work function is as the minimum amount of energy which is required to remove an electron to infinity from its source. It was defined in the concept of photoelectric effect in which a light is incident upon the metal and the electrons are ejected from the metal.

CBSE Sample Papers for Class 12 Economics Term 2 Set 4 with Solutions

Students can access the CBSE Sample Papers for Class 12 Economics with Solutions and marking scheme Term 2 Set 4 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Economics Term 2 Set 4 with Solutions

Time allowed: 2 Hours
Maximum Marks: 40

General Instructions:

  • This is a Subjective Question Paper containing 13 questions.
  • This paper contains 5 questions of 2 marks each, 5 questions of 3 marks each and 3 questions of 5 marks each.
  • 2 marks questions are Short Answer Type Questions and are to be answered in 30-50 words.
  • 3 marks questions are Short Answer Type Questions and are to be answered in 50-80 words.
  • 5 marks questions are Long Answer Type Questions and are to be answered in 80-120 words.
  • This question paper contains Case/Source Based Questions.

CBSE Sample Papers for Class 12 Economics Term 2 Set 4 with Solutions

Question 1.
“Final goods include only those goods which are consumed by the households”. Defend or refute the given statement with valid reason. (2)
Answer:
The given statement is refuted as final goods include those goods which are either consumed by the households or purchased by a producer for investment purposes.

Question 2.
When are actual stocks greater than desired stocks?
OR
Answer the following questions based on the figure given below:
CBSE Sample Papers for Class 12 Economics Term 2 Set 4 With Solutions 1
At which level of income, Average Propensity to Consume will be equal to one and why? (2)
Answer:
When aggregate demand falls short of the expectations of the producers, actual stocks are greater than desired stocks. Some Output remains unsold.
OR
Average Propensity to Consume will be equal to one at point B, as here Average Propensity to Save is zero.

Question 3.
If a consumption function of a hypothetical economy is given as C = 100 + 0.6 Y, then
(A) What will be the values of marginal propensity to consume and marginal propensity to save for the economy?
(B) Write the corresponding saving functions.
OR
From the following data calculate investment expenditure:
(i) Marginal propensity to save = 0.2
(ii) Equilibrium level of income = ₹22,500
(iii) Autonomous consumption = ₹500 (2)
Answer:
(A) C = 100 + 0.6 Y (given)
So, MPC = 0.6
MPS = 1 – MPC = 1
– 0.6 = 0.4

CBSE Sample Papers for Class 12 Economics Term 2 Set 4 with Solutions

(B) S = – C + (l- b)Y
S = – 100 + 0.4 Y
OR
Y = \(\bar{C}\) + (1 – MPS)Y + I
₹22,500 = ₹500 + (1 – 0.2)
₹22.500 + I
I = ₹22.500 – ₹500 – ₹18.000
= ₹4.000

Question 4.
‘Water has become an economic commodity.’ Justify the statement.
OR
You might have seen and heard on TV news or read in newspapers about foreigners flocking to India for surgeries, liver transplants, dental and even cosmetic care. Why? (2)
Answer:
Water has become an economic commodity because drinking water is not readily available in the world. We pay monthly water bills for the consumption of water. We buy water for drinking in the form of bottled water. Since we pay for water on the basis of supply and demand, it would not be technically wrong to view water as an economic commodity. Although water is not yet a formal commodity for sale on a formal basis, it will likely be within the next two decades.
OR
Because our health services combine latest medical technologies with qualified professionals and is cheaper for foreigners as compared to costs of similar health care services in their own countries. In the year 2004-05, as many as 1,50,000 foreigners visited India for medical treatment. And this figure is likely to increase by 15 percent each year.

CBSE Sample Papers for Class 12 Economics Term 2 Set 4 with Solutions

Question 5.
Raj is going to school. When he is not in school, you will find him working on his farm. Can you consider him as a worker? Why? (2)
Answer:
Yes, he will be considered as a worker because all those who are engaged in economic activities, in whatever capacity – high or low, are workers. Raj is also engaged in an economic activity as he is contributing to the gross national product of the economy.

Question 6.
Compare and analyse the given data of India and China with valid arguments.
Annual Growth of Gross Domestic Product (%), 1980 – 2017

Country 1980 – 90 2015 – 2017
India 5.7 7.3
China 10.3 6.8

Source: Key Indicators for Asia and Pacific 2016, Asian Development Bank, Philippines: World Development Indicators 2018
Answer:
The given data shows that China has gained economic strength over the years. When many developed countries were finding it difficult to maintain a growth rate of even 5%, China was able to maintain near double-digit growth during the decade of 1980s. The growth rate o’ China has decelerated to an average of 6.8%, over the period 2015-17.

In the recent past India has posted a decent rise in the growth rate. While India had maintained a reasonable growth rate of 5.7% in the decade of 1980’s it has shown great caliber and character in the period 2015-17 by registering an average of 7.3%, over the period 2015-17. Nevertheless, Indian elephant has to travel a long distance before it could present itself as a real threat to the growth story of the Chinese dragon.

CBSE Sample Papers for Class 12 Economics Term 2 Set 4 with Solutions

Question 7.
“The one-child policy produced consequences beyond the goal of reducing population growth.” Explain.
OR
Group the following features pertaining to the economies of India, China and Pakistan under three heads:

  • One-child norm
  • Low fertility rate
  • High degree of urbanisation
  • Mixed economy
  • Very high fertility rate
  • Large population
  • High density of population
  • Growth due to manufacturing sector
  • Growth due to service sector (3)

Read the following case carefully and answer question number 8 and 9 given below :
Ramesh is a tailor and he also owns a shop. He is famous quality and comfortable women’s and men’s clothing for a casual lifestyle. Ramesh stitches only for households. In a single day he earns ₹1,000 from stitching the clothes. Over this day, his equipment such as swing machines, scissors, measuring tape, etc. depreciates in the value by ₹100. Out of his remaining income, i.e., ₹900, Ramesh pays sales tax worth ₹60. He takes ₹400 to his home and keeps ₹440 for improvement and buying of new equipment. He further pays ₹40 as income tax from his income.
Answer:
One-child norm introduced in China in the late 1970s is the major reason for low population growth. It is stated that this measure led to a decline in the sex ratio, that is, the proportion a females per 1000 males. One child norm and the resultant arrest in the growth of pollution also have other implications. For instance after a few decades, in China, there will be more elderly people in proportion to young people, and also reduced the fertility rate considerably.
OR

India China Pakistan
Mixed economy One-child norm High degree of urbanisation Mixed economy
Large population Low fertility rate Very high fertility rate
High density of population High degree of urbanisation
Large population
Growth due manufacturing sector

CBSE Sample Papers for Class 12 Economics Term 2 Set 4 with Solutions

Question 8.
Calculate the value of net value added at factor cost by Ramesh. (3)
Answer:
Gross value added at market price (GVAMP) = Ramesh’s contribution to GDP = ₹1.000 NVAMP = GVAMP – Depreciation = ₹1.000 – ₹100 = ₹900
NVAFC = NVAMP – Net Indirect Taxes = ₹900 – ₹60 = ₹840

Question 9.
What is the difference between ‘market price’ or ‘factor cost’ in reference to value-added? When will be market price and factor cost equal? (3)
Answer:
Factor cost is the total cost of all the factors of production consumed or used in producing a good or service. Whereas, market price is the price at which a product is sold in the market. Market price and Factor cost will be equal when there is no indirect taxes and subsidy.

Factor cost = Market price – Indirect tax + Subsidies
Factor cost = Market price – 0 + 0
Factor cost = Market price

Question 10.
What will happen if there is no additional employment generated in the economy even though we are able to produce goods and services in the economy? How could jobless growth happen? (3)
Answer:
The country is going through a structural change and shifting to the modern techniques using the capital-intensive method of production, which is cost-effective and gives more output by employing less labor. Thus, in India employment growth started declining and reached the level of growth that India had in the early stages of planning. This means that in the Indian economy, without generating employment, we have been able to produce more goods and services. This phenomenon is known as jobless growth.

CBSE Sample Papers for Class 12 Economics Term 2 Set 4 with Solutions

Question 11.
“Ruling out any impact of stimulus on the price situation, Chief Economic Advisor K.V. Subramanian on Thursday said the COVID-19 pandemic has severely dented the demand for non-essential or discretionary goods.”

Identify the situation stated in the above lines and explain any two measures to correct them. (5)
Answer:
The situation stated in the given lines is a Deflationary condition. It is that situation when Aggregate Demand is lesser than Aggregate Supply corresponding to full employment level.

Two fiscal measures to control it are:

  1. Decrease in Taxes: To curb the deflationary gap the government may decrease the taxes. This may increase the purchasing power in the hands of the people which in turn may increase the Aggregate Demand in the economy to bring it equal to the Aggregate Supply.
  2. Increase in Government Expenditure: To curb the deflationary gap the government may increase its expenditure. This may increase the purchasing power in the hands of the people which in turn may increase the Aggregate Demand in the economy to bring it equal to the Aggregate Supply.

Question 12.
(A) Find gross national product at market price. (₹ in crores)
(i) Private final consumption expenditure 800
(ii) Net current transfers to abroad 20
(iii) Net factor income to abroad (-)10
(iv) Government final consumption expenditure 300
(v) Net indirect tax 150
(vi) Net domestic capital formation 200
(vii) Depreciation 100
(viii) Net imports 30
(ix) Income accruing to government 90
(B) State any two precautions to be taken while using the expenditure method of measuring national income?
OR
(A) Calculate Net Domestic Product at Factor Cost: (₹ crore)
(i) Gross National Disposable Income 600
00 Net current transfers to abroad (-) 20
(iii) Consumption of fixed capital 60
(iv) Indirect tax 100
(v) Subsidies 10
(vi) Net factor income to abroad (-) 10
(vii) National debt interest 40

(B) When will be the domestic factor income greater than national income? (5)
Answer:
(A) GNPMP = Private final consumption expenditure + Government final consumption expenditure + Net domestic capital formation + Depreciation – Net imports – Net factor income to abroad = 800 + 300 + 200 + 100 – 30 – (-)10 = ₹1380 crore

CBSE Sample Papers for Class 12 Economics Term 2 Set 4 with Solutions

(B) The following precautions to be taken while using the expenditure method of measuring national income:

  • Expenditure on second-hand goods is not to be included.
  • Expenditure on shares and bonds is not to be included.

OR

(A) NDPFC = Gross National Disposable Income – Consumption of fixed capital + Net current transfers to abroad-indirect tax + Subsidies + Net factor income to abroad
= 600 – 60 + (-20) – 100 + 10 + (-10)
= ₹420 Crore

(B) National Income = Domestic Factor Income + Net Factor Income from Abroad
Thus, when net factor income from abroad is negative, domestic factor income is greater than national income.

Question 13.
(A) “Ujjwala Yojana has been a game-changer for rural India.” State any three conventional fuels being targeted under the LPG cylinder distribution scheme (Ujjwala Yojana).

(B) “The Indian Health System needs a stronger does of public expenditure to cure itself.” Justify the given statements with valid arguments. (5)
Answer:
(A) The conventional sources of energy cause environmental pollution therefore the government have introduced the ‘Ujjwala Yojana as a game-changer for rural India by providing free LPG gas cylinders (cleaner fuel) to rural households.

The three conventional fuels targeted under Ujjawala Yojana are:

  • Agricultural waste and dried dung
  • Firewood
  • Coal

(B) The statement is defended as the improvement in the health system in India has been unreasonably slow since independence. Indian health system has been a victim of a relatively low public expenditure.

CBSE Sample Papers for Class 12 Economics Term 2 Set 4 with Solutions

The health expenditure as a percentage of GDP is abysmally low as compared to some of the major developing countries. It stood at around 4.7% of the total GDP in the year 2014-15. Thus, actually Indian health system needs the increased dose of public expenditure to cure itself.

CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions

Students can access the CBSE Sample Papers for Class 12 Chemistry with Solutions and marking scheme Term 2 Set 8 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 35

General Instructions:

  • There are 12 questions in this question paper with internal choice.
  • SECTION A – Q. No. 1 to 3 are very short answer questions carrying 2 marks each.
  • SECTION B – Q. No. 4 to 11 are short answer questions carrying 3 marks each.
  • SECTION C- Q. No. 12 is case based question carrying 5 marks.
  • All questions are compulsory.
  • Use of log tables and calculators is not allowed.

Section – A
(Section A-Question No 1 to 3 are very short answer questions carrying 2 marks each.)

Question 1.
What is meant by the following terms?
(i) Cyanohydrin
Answer:
-OH group and cyano group are present on same carbon atom. Addition of HCN to carbonyl group in weakly acidic medium forms cyanohydrin.
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 1

(ii) Acetal (2)
Answer:
Acetal : Terminal C atom has two alkoxy groups. Two equivalents of monohydric alcohol add to 1 equivalent of aldehyde in presence of dry HCl gas.
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 2
Caution:
Students should draw the related structures to get full marks.

CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions

Question 2.
Arrange the following as instructed: (Any two)
(A) In an increasing order of basic strength CH6H5NH2, C6H5N(CH3)2 (C2H6)2 NH and CH3 NH2.
Answer:
C6H5NH2 < C6H5N(CH3)2 < CH3NH2 < (C2H5)62NH.

Explanation:
In C6H5N(CH3)2 presence of two CH3 groups (increases the electron density of N-atom) makes it . more basic than C6H5NH3 but less basic than (C2H5)2NH2 and CH3NH2 due to the presence of aromatic ring which is responsible for the delocalisation of lone pair of electrons of N-atom over the benzene ring (decreases the electron density of N-atom).

(B) In a decreasing order of basic strength Aniline, p-nitroaniline and p-toluidine.
Answer:
p-nitro aniline < Aniline < p-toluidine

Explanation:
In p-toluidine, the presence of electron-donating-CH3 group increases the electron density on the N-atom.
Thus, p-toluidine is more basic than aniline. On the other hand, the presence of electron – withdrawing – NO2 group decreases the electron density over the N-atom in p-nitroaniline. Thus, p-nitroaniline is less basic than aniline.

(C) In an increasing order of pKb values
C2H5NH2, C6H5NHCH3, (C2H5)2 NH and C6H5NH2 (2)
Answer:
(C2H5)2 NH < C2H5NH2 < C6H5NHCH3 < C6H5NH2.

Explanation:
In C2H5NH2, only one -C2H5 group is present while in (C2H5)22NH, two – C2H5 groups are present. Thus, the +1 effect is more in (C2H5)2NH than in C2H5NH2. Therefore, the electron density over the N-atom is more in (C2H5)2NH than in C2H5NH2. Hence, (C2H5)2NH is more basic than C2H5NH2.

Also, both C6H5NHCH3 and C6H5NH2 are less basic than (C2H5)2NH and C2H5NH2 due to the delocalization of the lone pair in the former two. Further, among C6H5NHCH3 and C6H5NH2, the former will be more basic due to the +1 effect of -CH3 group.

Question 3.
What is meant by rate of a reaction? Differentiate between average rate and instantaneous rate of a reaction. (2)
Answer:
Rate of a chemical reaction is the change in the concentration of any one of the reactants or products per unit time. It is expressed in mol L-1 s-1 or Ms-1 or atm time-1 units.

The average rate of a reaction is defined as the rate of change of concentration of a reactant (or of a product) over a specified measurable period of time.
Instantaneous rate of reaction gives the tendency of the reaction at a particular point of time during its course (or) The time derivative of the concentration of a reactant (or product) converted to a positive number is called the instantaneous rate of reaction.

Rate of disappearance of R
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 3

CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions

Section – B
(Section B-Question No 4 to 11 are short answer questions carrying 3 marks each.)

Question 4.
Write the IUPAC names of the following coordination compounds:
(i) [Co(NH3)6]Cl3
(ii) [Cr(NH3)5Cl]Cl2
(iii) K3[Fe(CN)6]
OR
Explain different types of ligands with one example of each. (3)
Answer:
(i) Hexaamminecobalt (III) chloride.
(ii) Pentaamminechloridochromium (III) chloride.
(iii) Potassium hexacyanidoferrate (III).
OR
The ions or molecules bound to central atom or ion in the coordination entity are ligands e.g. [Fe(CN)6]4- has six CN- ligands.

Types:

  1. On the basis of charges on them ligands can be negative, positive (e.g. H3O+. NH4+ etc) or neutral (eg. CO, NH3, H2O).
  2. On the basis of their donor atoms ligands can be monodentate or unidentate (one donor atom) e.g- NH3, H2O, Cl- etc or didentgte (two donor atoms) H2NCH2CH2NH2 or C2O42- etc or polydentate (several donor atoms) eg. [EDTA]4- is a hexadentate ligand.
  3. Ligands which can ligate through two different atoms are called ambidentate ligands eg. NO2– and SCN– ions whereas when a di- or polydentate ligand uses its two or more donor atoms to bind a single metal ion, it is called chelate ligand.

Question 5.
The conductivity of 0.001 mol L-1 solution of CH3COOH is 3.905 × 10-5 S cm-1. Calculate its molar conductivity and degree of dissociation (a).
Given: λ°(H+) = 349.6 S cm2 mol-1 and λ° (CH3COO–) = 40.9 S cm2 mol-1 (3)
Answer:
5. C = 0.001 mol L-1, k = 3.905 x 10-5 S cm-1

Molar conductivity
K = 3.905 × 10-5 S cm-1 ∧cm = ?

Using formula,
∧cm = \(\frac{K \times 1000}{C}=\frac{3.905 \times 10^{-5} \times 1000}{0.001}\)
=39.05 S cm2 mol-1

Molar conductivity at infinite dilution:
CH3COOH → CH3COC– + H+
∧°m = λ°H++ λ°CH3COO
= (349.6 + 40.9)
∧°m = 390.5 S cm2 mol-1

Degree of dissociation:
α = \(\frac{\wedge^{c} \mathrm{~m}}{\wedge^{\circ} \mathrm{m}}=\frac{39.05}{390.5}\)
∴α = 0.1

Question 6.
A first order gas phase reaction : A2B2(g) → 2A(g) + 2B(g) at the temperature 400°C
has the rate constant k = 2.0 × 10-4 sec-1. What percentage of A2B2 is decomposed on heating for 900 seconds? (Antilog 0.0781 = 1.197).
OR
The thermal decomposition of HC02H is a first order reaction with a rate constant of 2.4 × 10-3 s-1 at a certain temperature. Calculate how long will it take for three-fourths of initial quantity of HCOOH to decompose, (log 0.25 = -0.6021) (3)
Answer:
Since the reaction is of the first order
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 4
OR
Given : K = 2.4 × 10-4 sec-1
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 5

CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions

Question 7.
(A) Write the electronic configuration of Ce3+ ion, and calculate the magnetic moment on the basis of the ‘spin-only’ formula. [Atomic No. of Ce = 58]
Answer:
Ce(58) : [Xe]4 f45d16s2
Ce3+(58): [Xe]4 f1

Spin only Formula
Magentic moments
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 6
= 1.732 B.M.
where ‘S’ is spin quantum number, Ce3+ has one unpaired electron which has spin quantum number equal to 1/2.

(B) Account for the following:
(i) The entholpies of atomisation of the transition metals are high.
Answer:
It is because of strong metallic bonds due to large number of unpaired electrons in d-orbitals.

Explanation:
The enthalpies of atomization of the transition metals are high because of large number of unpaired electrons in their atoms, they have stronger inter atomic interaction and hence strong metallic bonding is present between atoms.

(ii) The lowest oxide of o transition metal is basic, the highest is amphoteric/ acidic. (3)
Answer:
It is because transition metals in lowest oxidation state are more metallic and in higher oxidation state are least metallic, therefore, oxides in Lower oxidation state are basic, whereas in higher oxidation state are amphoteric/acidic

Explanation:
In Low oxidation state of the metaL, some of the valence electrons of the metal atom are not involved in bonding. Hence it can donate electrons and behave as a base. On the other hand, in higher oxidation state of the metal, valence electrons are involved in bonding and are not available. Instead effective nuclear charge is high and hence it can accept electrons and behave as an acid.

Question 8.
(A) Arrange the following complex ions in increasing order of crystal field splitting energy ():
[Cr(Cl)6]3-, [Cr(CN)6]3-, [Cr(NH3)6]3+.
Answer:
Crystal field splitting energy AO increases
in the order:
[Cr(Cl)6]3- < [Cr(NH3)6]3+ < [Cr(CN)6]3-

Explanation:
Among the ligands Cl, NH3 and CN, Cl is the weakest ligand and CN is the strongest one. Therefore, increasing order of crystal field splitting energy A0 is:
[Cr(Cl)6]3- < [Cr(NH3)6]3+ < [Cr(CN)6]3-

(B) Why do compounds having similar geometry have different magnetic moments?
Answer:
Strong field ligand can easily cause the pairing of electrons while the weak field Ligands are not able to form pairs. The magnetic moment of a compound depends on the number of unpaired or paired electrons. Hence it is different for compounds having similar geometry.
Explanation – If CFSE is high, the complex will show low value of magnetic moment and vice versa, e.g. [CoF6]3- and [Co(NH3)6]3+, the former is paramagnetic and the latter is diamagnetic.

(C) Name the type of Isomerism when ambidentate Ligands are attached to o central metal ion. Give one example this isomerism. (3)
Answer:
Linkage Isomerism is a type of isomerism when ambidentate ligands get attached to central metal ions.

Examples:
[Co(NH3)5ONO]Cl2(Pentaammine nitrito cobalt (III) chloride) – O – attached. (Red in colour) and [CO(NH3)5NO2]Cl2 (Pentaammine nitro cobalt (III) chloride) – N – attached (Yellow-brown in colour)

Related Theory:
The Ligands which have two binding sites are known as Ambidendate ligands. Some of the examples are: Nitrite-N, Nitrito-0 and Isothidcyanato, Thiocyanato.

Question 9.
Predict the products in the followng reactions
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 7
OR
Two motes of compound (A) on treatment with a strong base gives two compounds (B) and (C). The compound (B) on dehydrogenation with Cu gives (A) white acidification of (C) gives carboxytic acid (D) having molecular formulo CH2O2. Identify (A) to (D). (3)
Answer:
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 8
Since (D) is a carboxylic acid with one carbon only, it is HCOOH. As it is obtained from (C) acidification, (C) COONa and (A) is HCHO which on treatment with strong base (NaOH) gives CH3OH & HCOONa (Cannizaro’s reaction).

The reactions are:
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 9

Question 10.
How would you account for the following:
(A) Etectrophitic susbstitution ¡n case of aromatic amines takes place more readily than benzene.
(B) Ethanamide is a weaker base than ethonamine.
(C) It is difficult to prepare pure amines by ammonotysis of atkyl halides. (3)
OR
Give the structures of A, B and C in the following reactions:
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 10
Answer:
(A) Due to the strong activating effect (+1) of the – NH2 group, aromatic amines undergo electrophilic substitution reactions readiLy than benzene.

(B) In case of acetamide due to resonance, the lone pair of electrons on the nitrogen atom is delocalized over keto group which decreases electron density hence less basic while in ethylamine due to +1 effect of ethyl group electron density increases on N-atom and hence basic character increases.

(C) By ammonolysis of alkyl halides, a mixture of primary, secondary and tertiary amines is formed. The separation of these amines is very diffcult.
Thus, it is very difficult to prepare pure amines by ammonolysis of alkyl halides.
OR
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 11

CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions

Question 11.
Answer the following questions:
(A) Benzaldehyde can be obtained from benzol chloride. Write reactions for obtaining benzol chloride and then benzaldehyde from it.
Answer:
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 12
Explanation:
It is the commercial method for preparing benzaldehyde. Benzal chloride can be obtained by photochlorination of toluene, i.e. chlorination of toluene in the presence of sunlight. Then, benzal chloride on heating with boiling water produces benzaldehyde.

(B) Name the electrophile produced in the reaction of benzene with benzoyt chloride in the presence of anhydrous AlCl3. Name the reaction also.
Answer:
The electrophile produced in the reaction of benzene with benzoyl chloride in the presence of anhydrous AlCl3 is benzoylinium cation (C6H5CO+). The product formed in this reaction is benzophenone. This reaction is called Friedel Craft’s acylation or benzoylation reaction.

Explanation:
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 13

(C) Give the structure of the following compound – 4-Nitro Propiophenone (3)
Answer:
4-Nitro Propiophenone
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 8 with Solutions 14

Section – C
(Section C-Question No 12 is case-based question carrying 5 marks.)

Question 12.
Read the passage given below and answer the following questions:
Hardly Schulze rule states that the precipitating effect of an ion on dispersed phase of opposite charge increases with the valency of the ion. The higher the valency of the flocculating ion, the greater is its precipitating power. Thus, for the precipitation of AS2S3 sol (-ve sol) the precipitating power of Al3+ > Ba2+ > Na and Na+ ion is of the orde Al3+ > Na2+ Na+. Similarly, for precipitating Fe(OH)3 sol (+ ve sol) the precipitating power of [Fe(CN)6]3-, SO442- and Cl– is of the order, [Fe(CN)6]3- > <SO42- > Cl–. The minimum concentration of an electrolyte in million per litre required to cause precipitation of a sol in 2 hours is called flocculation value.

The smaller the flocculation value, the higher will be the coagulating power of the ion. The minimum mass of the protective colloid (lyophilic colloid) in milligrams that must be added to 10 ml. of a standard red gold sol so that no coagulation occurs when I ml. of 10% NaCl solution is rapidly added to it is called the gold number of the protective colloid.

(A) Arrange the following ions in the increasing order of their flocculation value:
Cl–, P043-, S042-, [Fe(CN)6]4-
(B) What is gold number?
(C) State Hardy Schulze rule.
(D) (i) Out of AlCl3 and KCl, which is more effective in causing coagulation of a negative sol and why?
(ii) What happens when an electrolyte is added to a hydrated ferric oxide sol in water and why?
OR
Explain the following:
(i) Deltas are formed when river and seawater meet.
(ii) Artificial rain is caused by spraying salt over clouds. (5)
Answer:
(A) [Fe(CN)6]4- < P043- < S042- < Cl–

Explanation:
More the charge on flocculating ion, less the flocculation value.

(B) The gold number is defined as the minimum mass of the colloid in milligram that is added to the 10ml of red gold sol to protect it from the coagulation when 1 ml of 10% NaCl is added.

(C) Hardy Schulze rule states that the amount of electrolyte required for the coagulation of a definite amount of a colloidal solution is dependent on the valency of the coagulating ion. Coagulating ion is the ion which has the charge opposite to the charge of the colloidat particles).

(D) (i) AlCl3, because Al3+ has higher charge than K+ ion. Higher the charge, more effective it will be for coagulation. Explanation: The greater the magnitude of the opposite charge, the higher the ability of a salt to coagulate the sol. Thus, trivalent salt AlCl3 is more effective in causing the coagulation of a negatively charged sol than monovalent salt KCl.

(ii) The positively charged colloidal particles of Fe(OH)3 get coagulated by the negatively charged ions provided by electrolyte. Explanation: When an electrolyte like KCl is added of Fe(OH)3 sol, the positively charged colloidal particles of Fe(OH)3 get coagulated by the oppositely charged Cl– ions provided by KCl.
OR
(D) (i) River water is a colloidal solution of clay. Sea water contains a number of electrolytes. When river water meets the sea water, the electrolytes present in sea water coagulate the colloidal solution of clay resulting in its deposition with the formation of deltas.

Explanation:
River water is the negatively charged colloidal solution of clay and sands, whereas sea water contains a number of electrolytes. At the meeting point of sea water and river water, the electrolytes present in sea water neutralize and coagulate the colloidal solution of clay and sand resulting in their deposition leading to the formation of delta.

(ii) Clouds are colloidal dispersion of water particles in air carrying some charge over them.
It is possible to cause artificial rain by throwing electrified sand or spraying a sol carrying charge opposite to the one on clouds from an aeroplane. The colloidal water particles present in the clouds will get neutralized and as result they will come closer and grow in size to form bigger water drops and ultimately cause artificial rain.

CBSE Sample Papers for Class 12 Geography Term 2 Set 5 with Solutions

Students can access the CBSE Sample Papers for Class 12 Geography with Solutions and marking scheme Term 2 Set 5 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Geography Term 2 Set 5 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 35
Roll No. ___________

General Instructions:

  • Question paper is divided into 5 sections A, B, C, D & E
  • In section A, question number 1 to 3 are Very Short Answer type questions. Attempt any 3 questions.
  • In section B, question number 4 is Source based question.
  • In section C, question number 5 & 6 are Short Answer type questions.
  • In section D, question number 7 to 9 are Long Answer type questions.
  • In section E, question number 10 is a Map based question.

Section – A
Very Short Answer Questions

Question 1.
Identify and explain any two factors affecting tourism. (2)
Or
Comment on the role of communication in today’s world.
Answer:
Two factors that affect tourism are

  1. Demand Since the last century, the demand for holidays has increased rapidly. Improvements in the standard of living and increased leisure time, permit many more people to go on holidays for leisure.
  2. Transport The opening-up of tourist areas has been aided by improvement in transport facilities. Travel is easier by car, with better road systems. More significant in recent years has been the expansion in air transport.

Or
The role of communication in today’s world is

  1. Telecommunication has revolutionised communications because of the speed with which messages are sent. The time reduced is from weeks to minutes.
  2. Radio and television through satellite communication also help to relay news, pictures, and telephone calls to vast audiences around the world and hence they are termed as mass media.
  3. They are vital for advertising and entertainment.

CBSE Sample Papers for Class 12 Geography Term 2 Set 5 with Solutions

Question 2.
State about state highways and district roads. (2)
Answer:
State Highways are constructed and maintained by state governments. They join the state . capitals with district headquarters and other important towns. These roads are connected to the National Highways. These constitute 4 per cent of total road length in the country. District Roads are the connecting link between District Headquarters and the other important nodes in the district. They account for 14 per cent of the total road length of the country.

Question 3.
Which are the most polluted stretches of the Ganga river and what are the sources contributing to the pollution?
Answer:
The most polluted stretches of the Ganga river are downstream of Kanpur, downstream of Varanasi and Farkka Barrage. The sources of pollution in the Ganga River are industrial pollution from towns like Kanpur, domestic wastes from urban centres and dumping of carcasses in the river. Cities of Kanpur, Allahabad, Varanasi, Patna and Kolkata release domestic waste into the river flowing through Uttar Pradesh, Bihar and West Bengal in India.

Section – B
Source Based Question

Question 4.
Read the source given below and answer the following questions by choosing the correct option.
Bauxite is the ore, which is used in manufacturing of aluminium. Bauxite is found mainly in tertiary deposits and is associated with laterite rocks occurring extensively either on the plateau or hill ranges of peninsular India and also in the coastal tracts of the country.

Odisha happens to be the largest producer of Bauxite. Kalahandi and Sambalpur are the leading producers. The other two areas which have been increasing their production are Bolangir and Koraput. The patlands of Lohardaga in Jharkhand have rich deposits. Gujarat, Chhattisgarh, Madhya Pradesh and Maharashtra are other major producers.

Bhavanagar, and Jamnagar in Gujarat have the major deposits. Chhattisgarh has bauxite deposits in Amarkantak Plateau while Katni Jabalpur area and Balaghat in M.P. have important deposits of bauxite. Kolaba, Thane, Ratnagiri, Satara, Pune and Kolhapur in Maharashtra are important producers. Tamil Nadu, Kamataka and Goa are minor producers of bauxite. Copper is an indispensable metal in the electrical industry for making wires, electric motors, transformers and generators.

It is alloyable, malleable and ductile. It is also mixed with gold to provide strength to jewellery. The Copper deposits mainly occur in Singhbhum district in Jharkhand, Balaghat district in Madhya Pradesh and Jhunjhunu and Alwar districts in Rajasthan. Minor producers of Copper are Agnigundala in Guntur District (Andhra Pradesh), Chitradurg and Hasan districts (Karnataka) and South Arcot district (Tamil Nadu).

i. State important features of copper. (1)
Answer:
Important features of copper are Copper is alloyable and melleable i.e. can be converted into thin sheets. . It is ductile i.e. can be drawn into thin wires.

ii. In which locations, bauxite is found? (1)
Answer:
Bauxite is found both on high elevations and near the shore. For example, Odisha, Jharkhand, Gujarat, Chhattisgarh and so on.

iii. The Balaghat district in Madhya Pradesh, and Jhunjhunu and Alwar districts in Rajasthan in India have deposits of which metal? (1)
Answer:
The Balaghat district in Madhya Pradesh, and Jhunjhunu and Alwar districts in Rahasthan in India have deposits of copper metal.

CBSE Sample Papers for Class 12 Geography Term 2 Set 5 with Solutions

Section – C
Short Answer Questions

Question 5.
Outline the distribution of iron and steel industry across the world. Or Identify the three subsectors of the cotton textile industry. Outline the distribution of cotton textile industry in the world. (3)
Answer:
The iron and steel industry is one of the most complex and capital-intensive industries and is concentrated in the advanced countries of North America, Europe and Asia. The distrubution of iron and steel industry across the world is

In USA, most of the production comes from the north Appalachian region (Pittsburgh), Great Lake region (Chicago-Gary, Erie, Cleveland, Lorain, Buffalo and Duluth) and the Atlantic Coast (Sparrows Point and Morisville). The industry has also moved towards the southern state of Alabama. Pittsburg area is now losing ground. It has now become the “rust bowl” of U.S.A.

In Europe, UK, Germany, France, Belgium, Luxembourgh, the Netherlands and Russia are the leading producers. The important steel centres are Scun Thorpe, Port Talbot, Birmingham and Sheffield in the U.K; Duisburg, Dortmund, Dusseldorf and Essen in Germany; Le Creusot and St. Ettienne in France; and Moscow, St. Petersburgh, Lipetsk, Tula, in Russia and Krivoi Rog, and Donetsk in Ukraine.

In Asia, the important centres include Nagasaki and Tokyo-Yokohama in Japan; Shanghai, Tienstin and Wuhan in China; and Jamshedpur, Kulti-Burnpur, Durgapur, Rourkela, Bhilai, Bokaro, Salem, Visakhapatnam and Bhadravati in India.
Or
Cotton textile industry has three sub-sectors i.e., handloom, powerloom and mill sectors

  1. Handloom sector is labour-intensive and provides employment to semi-skilled workers. It requires small capital investment. This sector involves spinning, weaving and finishing of the fabrics.
  2. The powerloom sector introduces machines and becomes less labour intensive and the volume of production increases.
  3. Cotton textile mill sector is highly capital intensive and produces fine clothes in bulk Cotton textile manufacturing requires good quality cotton as raw material.
  4. India, China, USA, Pakistan, Uzbekistan, Egypt produces more than half of the world’s raw cotton.
  5. The UK, NW European countries and Japan also produce cotton textile made from imported yarn Europe alone accounts for nearly half of the world’s cotton imports.

CBSE Sample Papers for Class 12 Geography Term 2 Set 5 with Solutions

Question 6.
Briefly outline the geographical location of the Bharmaur region of Himachal Pradesh. (3)
Answer:
Bharmaur is a tehsil in Chamba district of Himachal Pradesh. It is a notified tribal area since 21st November, 1975. The geographical location and features of the Bharmaur region are

  • This region lies between 32° 11′ N and 32°41′ N latitudes and 76° 22′ E and 76° 53’E longitudes.
  • It is spread over an area of about 1,818 sq km, the region mostly lies between 1,500 m to 3,700 m above the mean sea level.
  • This region popularly known as the homeland of Gaddis is surrounded by lofty mountains on all sides. It has Pir Panjal in the north and Dhaula Dhar in the south.
  • In the east, the extension of Dhaula Dhar converges with Pir Panjal near Rohtang Pass.
  • The river Ravi and its tributaries, the Budhil and the Tundahen, drain this territory, and carve out deep gorges. These rivers divide the region into four physiographic divisions called Holi, Khani, Kugti and Tundah areas.
  • Bharmaur experiences freezing weather conditions and snowfall in winter. Its mean monthly temperature in January remains 4°C and in July 26°C.

Section – D
Long Answer Questions

Question 7.
Industries are classified based on their sizes depending on the investme and output. Explain the basis of size based classification in industries. (5)
Or
Raw material is critical for functioning of an industry. How are industries classified based on raw materials?
Answer:
The size of an industry is determined by the capital invested, number of workers employed and volume of production determine the size of industry. Accordingly, industries may be classified into household or cottage, small-scale and large-scale on the basis of size

Household or Cottage Industries It is the smallest manufacturing unit. The artisans use local raw materials and simple tools to produce everyday goods in their homes with the help of their family members or part-time labour. Finished products may be for consumption in the same household or, for sale in local (village) markets, or, for barter.

Some common everyday products produced in this sector of manufacturing include foodstuffs, fabrics, mats, containers, tools, furniture, shoes, and figurines from wood lot and forest, shoes, thongs and other articles from leather, pottery and bricks from clays and stones.

Small Scale Manufacturing It is distinguished from household industries by its production techniques and place of manufacture (a workshop outside the home/cottage of the producer). This type of manufacturing uses local raw material, simple power-driven machines and semi-skilled labour. It provides employment and raises local purchasing power. Therefore, countries like India, China, Indonesia and Brazil, etc. have developed labour-intensive small scale manufacturing in order to provide employment to their population.

Large Scale Manufacturing It involves a large market, various raw materials, enormous energy, specialised workers, advanced technology, assembly-line mass production and large capital. This kind of manufacturing developed in the last 200 years, in the United Kingdom, NorthEastern USA and Europe. Now it has diffused to almost all over the world. The industries can be classified on the basis of raw material as

Agro Based Industries Agro processing involves the processing of raw materials from the field and the farm into finished products for rural and urban markets. Major Agro-processing industries are food processing, sugar, pickles, fruits juices, beverages (tea, coffee and cocoa), spices and oils fats and textiles (cotton, jute, silk), rubber, etc.

Mineral Based Industries These industries use minerals as a raw material. Some industries use ferrous metallic minerals which contain ferrous (iron), such as iron and steel industries but some use non-ferrous metallic minerals, such as aluminium, copper and jewellery industries. Many industries use non-metallic minerals such as cement and pottery industries.

Chemical Based Industries Such industries use natural chemical minerals, e.g. mineral-oil (petroleum) is used in petrochemical industry. Salts, sulphur and potash industries also use natural minerals. Synthetic fibre, plastic, etc. are other examples of chemical based industries.

Forest Based Industries Forests provide many major and minor products which are used as raw material. Timber for furniture industry, wood, bamboo and grass for paper industry, lac for lac industries come from forests.

Animal Based Industries Leather for leather industry and wool for woollen textiles are obtained from animals. Besides, ivory is also obtained from elephant’s tusks.

CBSE Sample Papers for Class 12 Geography Term 2 Set 5 with Solutions

Question 8.
Explain the concept of Trans-continental Railways with any two relevant and well known examples from world. (5)
Answer:
Trans-continental railways run across the continent and link its two ends. They were constructed for economic and political reasons to facilitate long runs in different directions. Since, trans-continental railways run across a continent, they cover large land mass and connects interior parts of the continent to major industrial and transportation hubs on the continent borders and ocean shores. These railways forms the backbone of many countries as they move a large amount of freight and passenger across large distances. Two of the well-known trans-continental railways in world are

(i) Trans-Siberian Railway This is a major rail route of Russia which runs from St. Petersburg in the west to Vladivostok on the Pacific Coast in the east passing through Moscow, Ufa, Novosibirsk, Irkutsk, Chita and Khabarovsk. It is the most important route in Asia and the longest (9,332 km) tracked and electrified trans-continental railway in the world.

It has helped in opening up its Asian region to West European markets. It runs across the Ural Mountains Ob and Yenisei rivers. There are connecting links to the south, namely, to Odessa (Ukraine), Baku on the Caspian Coast, Tashkent (Uzbekistan), Ulan Bator (Mongolia), and Shenyang (Mukden) and Beijing in China.

(ii) Trans-Canadian Railways This 7,050 km long rail-line in Canada runs from Halifax in the east to Vancouver on the Pacific Coast passing through Montreal, Ottawa, Winnipeg and Calgary. It was constructed in 1886, initially as part of an agreement to make British Columbia on the west coast join the Federation of States.

Later on, it gained economic significance because it connected the Quebec-Montreal Industrial Region with the wheat belt of the Prairie Region and the Coniferous Forest region in the north. Thus, each of these regions became complementary to the other. A loop line from Winnipeg to Thunder Bay (Lake Superior) connects this rail-line with one of the important waterways of the world. This line is the economic artery of Canada. Wheat and meat are the important exports on this route.

CBSE Sample Papers for Class 12 Geography Term 2 Set 5 with Solutions

Question 9.
Waterways have been used for transport of people and cargo since medieval times. Elucidate the advantages and types of waterways transport with examples. (5)
Answer:
Water transport is an essential form of transport. It is associated with waterbodies such as lakes, rivers, seas and oceans. The advantages of waterways are

Transport through waterways doesn’t require construction of a new route as an already existing water body is used for the transport. Movement through water offers less friction compared to roads and hence is more energy efficient.

Compared to land and air, ocean transport is a cheaper means of haulage (carrying of load) of bulky material over long distances from one continent to another. Water transport is broadly divided into sea routes and inland waterways

Sea routes The oceans offer a smooth highway traversable in all directions with minimal maintenance costs. Some of the important sea routes are the Northern Atlantic sea route linking USA to Europe and the Mediterranean-Indian ocean route linking regions along the South China Sea, Strait of Malacca, Indian Ocean, Red Sea, Suez Canal and Mediterranean.

Inland Waterways Rivers, canals, lakes and coastal areas are important inland waterways. The development of inland waterways is dependent on the navigability width and depth of the channel, continuity in the water flow, and transport technology in use. Important waterways are the Rhine Waterways through Germany and the Netherlands. It is navigable for 700 km; and Volga Waterway in Russia with a navigable waterway of 11,200 km.

CBSE Sample Papers for Class 12 Geography Term 2 Set 5 with Solutions

Section – E
Map Based Question

Question 10.
On the political map of the world, identify the places (Attempt any 5). (1 × 5 = 5)
A. A place of secondary activities
B. A major sea port
C. A major sea port
D. An international airport
E. A major airport
F. The Terminal Station of Trans-Continental Railway
CBSE Sample Papers for Class 12 Geography Term 2 Set 5 with Solutions 1
Answer:
CBSE Sample Papers for Class 12 Geography Term 2 Set 5 with Solutions 2

CBSE Sample Papers for Class 12 Geography Term 2 Set 4 with Solutions

Students can access the CBSE Sample Papers for Class 12 Geography with Solutions and marking scheme Term 2 Set 4 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Geography Term 2 Set 4 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 35
Roll No. ___________

General Instructions:

  • Question paper is divided into 5 sections A, B, C, D & E
  • In section A, question number 1 to 3 are Very Short Answer type questions. Attempt any 3 questions.
  • In section B, question number 4 is Source based question.
  • In section C, question number 5 & 6 are Short Answer type questions.
  • In section D, question number 7 to 9 are Long Answer type questions.
  • In section E, question number 10 is a Map based question.

Section – A
Very Short Answer Questions

Question 1.
Differentiate between the characteristics of large scale manufacturing and small scale manufacturing (2)
Or
Differentiate between private sector industries and joint sector industries.
Answer:
The large scale manufacturing is characterised by a number of supporting factors like a large market, various raw materials, enormous use of energy, specialised workers, advanced technology, assembly line mass production and large capital investments. On the other hand, the characteristics of small scale manufacturing are use of local raw material, simple power driven machines and semi-skilled labour.
Or
Private sector industries are owned by individual investors. These are managed by private organisations. On the other hand, Joint sector industries are managed by joint stock companies or sometimes the private and public sectors together establish and manage the industries.

CBSE Sample Papers for Class 12 Geography Term 2 Set 4 with Solutions

Question 2.
How has the Border Road Organisation (BRO) contributed to road transport in India? (2)
Answer:
Border Road Organisation (BRO) has contributed to road transport in India in many ways, some of which are . It has constructed roads in high altitude mountainous terrain joining Chandigarh with Manali (Himachal Pradesh) and Leh (Ladakh). This road runs at an average altitude of 4,270 metres above the mean sea level. Apart from the construction and maintenance of roads in strategically sensitive areas, the BRO also undertakes snow clearance in high altitude areas.

Question 3.
State in brief the types of pollutants involved in water pollution. Also mention sources of pollution for this. (2)
Answer:
In water pollution, the types of pollutants involved are dissolved and suspended solids, ammonia and urea, nitrate and nitrites, chloride, fluoride, carbonates, oil and grease, insecticide and pesticide residue, tannin, coliform MPM (bacterial count) sulphates and sulphides, heavy metals like lead, arsenic, mercury and manganese, radioactive substances, etc. Some of the major sources of water pollution are sewage disposal, urban run-off, toxic effluents from industries, run-off over cultivated lands and nuclear power plants.

Section – B
Source Based Question

Question 4.
Read the source given below and answer the following questions by choosing the correct option.
Railways are a mode of land transport for bulky goods and passengers over long distances. The railway gauges vary in different countries and are roughly classified as broad (more than 1.5 m), standard (1.44 m), metre gauge (1 m) and smaller gauges.

The standard gauge is used in the UK Commuter trains are very popular in UK, USA, Japan and India. These carry millions of passengers daily to and from in the city. There are about 13 lakh km of railways open for traffic in the world. Europe has one of the most dense rail networks in the world. There are about 4,40,000 km of railways, most of which is double or multiple-tracked.

Belgium has the highest density of 1 km of railway for every 6.5 sq. kms area. The industrial regions exhibit some of the highest densities in the world. The important rail heads are London, Paris, Brussels, Milan, Berlin and Warsaw. Passenger transport is more important than freight in many of these countries. Underground railways are important in London and Paris. Channel Tunnel, operated by Euro Tunnel Group through England, connects London with Paris.

Trans-continental railway lines have now lost their importance to quicker and more flexible transport systems of airways and roadways. In Russia, railways account for about 90 per cent of the country’s total transport with a very dense network west of the Urals. Moscow is the most important rail head with major lines radiating to different parts of the country’s vast geographical area.

Underground railways and commuter trains are also important in Moscow. North America has one of the most extensive rail networks accounting for nearly 40 per cent of the world’s total. In contrast to many European countries, the railways are used more for long-distance bulky freight like ores, grains, timber and machinery than for passengers. The most dense rail network is found in the highly industrialised and urbanised region of East Central USA and adjoining Canada.

i. The West-East Australian railway line runs across the country in which regions? (1)
Answer:
The West-East Australian railway line runs across the country from Perth to Sydney.

ii. Which continent has the largest network of railways in the world? (1)
Answer:
Asia has the largest network of railways in the world.

iii. What is the common form of public transport in London and Moscow? (1)
Answer:
A common form of public transport in London and Moscow is underground railways.

CBSE Sample Papers for Class 12 Geography Term 2 Set 4 with Solutions

Section – C
Short Answer Questions

Question 5.
Differentiate between rural marketing centres and urban marketing centres. (3)
Answer:
Differences between rural marketing centres and urban marketing centres are

Rural Marketing Urban Marketing
Rural marketing centres cater to nearby settlements. These are quasi-urban centres They serve as trading centres of the most rudimentary type. Urban marketing centres have more  widely specialised urban services. They provide ordinary goods and services as well as many of the specialised goods and services required by people.
In these centres, personal and professional services are not well-developed. These form local collecting and distributing centres. Most of these have mandis (wholesale markets) and also retailing areas. Urban centres, therefore, offer manufactured goods as well as many specialised markets develop, e.g.,  markets for labour, housing, semi or finished products.
They are not actually urban centres but are significant centres for making available goods and services which are most frequently demanded by rural folk. Services of educational institutions and professionals such as teachers, lawyers, consultants, physicians, dentists  and veterinary doctors are available.

Question 6.
Outline the distribution of sources of bauxite in India and mention any one use of this mineral. Classify minerals on the basis of chemical and physical properties. (3)
Answer:
Bauxite is found mainly in tertiary deposits and is associated with laterite rocks occurring extensively either on the plateau or hill ranges of peninsular India and also in the coastal tracts of the country. The distribution of bauxite in India is

→ Odisha happens to be the largest producer of Bauxite. Kalahandi and Sambalpur are the leading producers. The other two areas which have been increasing their production are Bolangir and Koraput.

→ The patlands of Lohardaga in Jharkhand have rich deposits of bauxite.

→ Gujarat, Chhattisgarh, Madhya Pradesh and Maharashtra are other major producers. Bhavanagar, and Jamnagar in Gujarat have the major deposits. Chhattisgarh has bauxite deposits in Amarkantak Plateau while Katni Jabalpur area and Balaghat in M.P. have important deposits of bauxite. Kolaba, Thane, Ratnagiri, Satara, Pune and Kolhapur in Maharashtra are important producers.

→ Tamil Nadu, Karnataka and Goa are minor producers of bauxite. Bauxite is the ore, which is used in manufacturing of aluminium.
Or
On the basis of chemical and physical properties, minerals may be grouped under two main categories of metallics and non-metallics. Metallic minerals are the sources of metals. Iron ore, copper, gold produce metal and are included in this category. Metallic minerals are further divided into ferrous and non-ferrous metallic minerals. Ferrous, as you know, refers to iron.

All those minerals which have iron content are ferrous such as iron ore itself and those which do not have iron content are non-ferrous such as copper, bauxite, etc. Non-metallic minerals are either organic in origin such as fossil fuels also known as mineral fuels which are derived from the buried animal and plant life such as coal and petroleum. Other type of non-metallic minerals are inorganic in origin such as mica, limestone and graphite, etc.

CBSE Sample Papers for Class 12 Geography Term 2 Set 4 with Solutions

Section – D
Long Answer Questions

Question 7.
What are the characteristics of modern large scale manufacturing? (5)
Or
What are traditional large scale industrial regions? Discuss the example of Ruhr coal field located in Germany.
Answer:
Modern large scale manufacturing has the following characteristics

→ Specialisation of Skills/Methods of Production Under the ‘craft’ method factories produce only a few pieces which are made-to-order. So, the costs are high. On the other hand, mass production involves production of large quantities of standardised parts by each worker performing only one task repeatedly and thereby reducing the overall cost.

→ Mechanisation It refers to using gadgets which accomplish tasks. Automation (without aid of human thinking during the manufacturing process) is the advanced stage of mechanisation. Automatic factories with feedback and closed loop computer control systems where machines are developed to think’, have sprung up all over the world. It reduces error due to human negligence, increase output due to use of machines and can work at any time due to automated instructions and minimal supervision. Overall, mechanisation of manufacturing process reduces error and increase output in a given period of time.

→ Technological Innovation Innovations through research and development strategy are an important aspect of modern manufacturing for quality control, eliminating waste and inefficiency, and combating pollution. With technological advancements, the machines and automated processes are regularly being upgraded, to reduce human interventions.
Or
Traditional Large-Scale Industrial Regions are based on heavy industry, often located near coal-fields and engaged in metal smelting, heavy engineering, chemical manufacture or textile production. These industries are now known as smokestack industries.

Traditional industrial regions can be recognised by –

  • High proportion of employment in manufacturing industry. High-density housing, often of inferior type, and poor services. Unattractive environment, for example, pollution, waste heaps, and so on.
  • Problems of unemployment, emigration and derelict land areas caused by closure of factories because of a worldwide fall in demand.

The Ruhr coal field is located in the East of Germany and represents one of the largest coal reserves in the country. This coal field is estimated to have over 42 billion tonnes of coal reserves. This has been one of the major industrial regions of Europe for a long time. Coal, iron and steel formed on the basis of the economy, but as the demand for coal declined, the industry started shrinking.

Even after the iron ore was exhausted, the industry remained, using imported ore brought by waterways to the Ruhr. The Ruhr region is responsible for 80 per cent of Germany’s total steel production Changes in the industrial structure have led to the decay of some areas, and there are problems of industrial waste and pollution.

The future prosperity of the Ruhr is based less on the products of coal and steel, for which it was initially famous, and more on the new industries like the huge Opel car assembly plant, new chemical plants, universities.

CBSE Sample Papers for Class 12 Geography Term 2 Set 4 with Solutions

Question 8.
Discuss the distribution of minerals in India. (5)
Answer:
Most of the metallic minerals in India occur in the peninsular plateau region in the old crystalline rocks. Over 97 per cent of coal reserves occur in the valleys of Damodar, Sone, Mahanadi and Godavari. Petroleum reserves are located in the sedimentary basis of Assam, Gujarat and Mumbai High ie., off-shore region in the Arabian Sea. New reserves have been located in the Krishna-Godavari and Kaveri basins. Most of the major mineral resources occur to the east of a line linking Mangaluru and Kanpur. Minerals are generally concentrated in three broad belts in India. These belts are

  1. The North-Eastern Plateau Region This belt covers Chhotanagpur (harkhand), Odisha Plateau, West Bengal and parts of Chhattisgarh
  2. The South-Western Plateau Region This belt extends over Kamataka, Goa and contiguous Tamil Nadu uplands and Kerala. This belt is rich in ferrous metals and bauxite. It also contains high grade iron ore, manganese and limestone.
  3. The North-Western Region This belt extends along Aravali in Rajasthan and part of Gujarat. Rajasthan is rich in building stones i.e. sandstone, granite, marble. Gypsum and Fuller’s earth deposits are also extensive.

CBSE Sample Papers for Class 12 Geography Term 2 Set 4 with Solutions

Question 9.
Petroleum is an essential fuel for several industries in an economy. State its uses in an economy and production in India. (5)
Answer:
Petroleum is a conventional fossil fuel. Its uses are .

  • It is an essential source of energy for all internal combustion engines in automobiles, railways and aircraft.
  • Its numerous by-products are processed in petrochemical industries, such as fertiliser, synthetic rubber, synthetic fibre, medicines, vaseline, lubricants, wax, soap and cosmetics.

The production of crude petroleum is

  • Digboi in Assam was the only oil producing region till 1956 but the scenario changed after 1956.
  • In Assam, Digboi, Naharkatiya and Moran are important oil producing areas.
  • The major oilfields of Gujarat are Ankaleshwar, Kalol, Mehsana, Nawagam, Kosamba and Lunej.
  • Mumbai High which lies 160 km off Mumbai was discovered in 1973 and production commenced in 1976.
  • Oil and natural gas have been found in exploratory wells in Krishna Godavari and Kaveri basin on the East coast.

Section – E
Map Based Question

Question 10.
On the political map of the world, identify the following features (Attempt any 5) (1 × 5 = 5)
A. A region of secondary activities
B. A major seaport
C. A secondary activity region in South-West USA
D. A major seaport
E. An important airport
F. The Terminal Station of Trans-Continental Railway
CBSE Sample Papers for Class 12 Geography Term 2 Set 4 with Solutions 1
Answer:
CBSE Sample Papers for Class 12 Geography Term 2 Set 4 with Solutions 2

CBSE Sample Papers for Class 12 Economics Term 2 Set 3 with Solutions

Students can access the CBSE Sample Papers for Class 12 Economics with Solutions and marking scheme Term 2 Set 3 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Economics Term 2 Set 3 with Solutions

Time allowed: 2 Hours
Maximum Marks: 40

General Instructions:

  • This is a Subjective Question Paper containing 13 questions.
  • This paper contains 5 questions of 2 marks each, 5 questions of 3 marks each and 3 questions of 5 marks each.
  • 2 marks questions are Short Answer Type Questions and are to be answered in 30-50 words.
  • 3 marks questions are Short Answer Type Questions and are to be answered in 50-80 words.
  • 5 marks questions are Long Answer Type Questions and are to be answered in 80-120 words.
  • This question paper contains Case/Source Based Questions.

CBSE Sample Papers for Class 12 Economics Term 2 Set 3 with Solutions

Question 1.
Distinguish between intermediate consumption and final consumption.
OR
Distinguish between domestic product and national product. (2)
Answer:
Intermediate Consumption refers to the expenditure incurred by a production unit on purchasing those goods and services from other production units which are meant for resale or for using up completely during the same year whereas Final consumption refers to the expenditure of those goods which are used either for consumption or for investment.
OR
Sum of the value of final products that take place within the domestic territory of a country is called domestic product, whereas the sum of contribution of residents of a country both within domestic territory or abroad is called national product.

Question 2.
If in an economy:
Change in initial investment (Δl) = ₹1,000 crores
Marginal propensity to save (MPS) = 0.2.
Find the value of the following:
(A) Investment multiplier (K)
(B) Change in final income (ΔY)
OR
Calculate change in final income, if Marginal Propensity to Consume (MPC) is 0 – 8 and change in initial investment is ₹1,000 crores. (2)
Answer:
(A) Investment multiplier (K) = 1/MPS
K = 10.2
K = 5
(B) Investment multiplier (K) = Δ Y/Δl
Substituting
K = 5
5 = ΔY/1000
ΔY = ₹5000 crores
OR
Investment Multiplier (K)
CBSE Sample Papers for Class 12 Economics Term 2 Set 3 With Solutions 3
Change in final income = ₹5,000 crores

CBSE Sample Papers for Class 12 Economics Term 2 Set 3 with Solutions

Question 3.
“An economy facing an unintended accumulation of inventories would try to reduce aggregate demand.’’ Do you agree with the given statement? Support your answer with valid reasons. (2)
Answer:
The given statement is not correct.
The situation of unintended accumulation of inventories arises when ex-ante aggregate demand is lesser than the ex-ante aggregate supply. This would pile up the stock with the producers, thus to tackle this situation the economy must increase aggregate demand (AD).

Question 4.
“Sustainable development is defined as an approach to developing or growing by using resources in a way that allows for them to renew or continue to exist for others.” In the light of this statement explain any one strategy of sustainable development. (2)
Answer:
Use of non-conventional sources of energy in India should be promoted. If we continue to depend upon the conventional sources like coal or petroleum products, we may end up with higher levels of pollution and an unsustainable environment. We should promote the use of non-conventional sources of energy like solar and wind power for a safer planet, to be passed on to the coming generations.

Question 5.
Discuss the need for on-the-job training for an employee.
OR
Analyze the distribution of employment by gender based in the following information:
CBSE Sample Papers for Class 12 Economics Term 2 Set 3 With Solutions 1
Answer:
Employers use on-the-job training methods for its employees to target an overall increase in the skills and efficiencies of the workers. On-the-job training leads to an increase in productivity of labor and production of goods. Such training keep the employees updated with the latest changes in their field of working.

CBSE Sample Papers for Class 12 Economics Term 2 Set 3 with Solutions
OR
Based on the given information, self-employment is a major source of livelihood for both men and women as this category accounts for more than 50 percent of the workforce in both diagrams. Casual wage work is the second major source for both men and women, a little more so for the latter (31 percent). When it comes to regular salaried employment, men are found to be so engaged in greater proportion. They form 20 percent whereas women form only 13 percent.

Question 6.
Giving reason state how are the following treated in estimation of national income.
(A) Payment of interest by an individual to a bank on a loan to buy a car.
(B) Expenditure by government on providing free educational services.
(C) Expenditure on purchasing a machine installed in a production unit.
OR
If in an economy the value of Net Factor Income from Abroad is ₹200 crores and the value of Factor Income to Abroad is ₹40 crores. Calculate the value of Factor Income from Abroad. (3)
Answer:
(A) Payment of interest to a bank by an individual is not included because the individual is a consumer.
(B) Expenditure by the government on free education is included because it is a final expenditure.
(C) Expenditure on machine installed in a production unit is included because it is an investment expenditure.
OR
Net Factor Income from Abroad = Factor Income from Abroad – Factor Income to Abroad ₹200 = Factor Income from Abroad – ₹40 Factor Income from Abroad = ₹200 + ₹40 = ₹240 crores

Question 7.
Study the following information and compare the Economies of India and Singapore on the grounds of ‘Investment in Infrastructure as a percentage of GDP’. (3)

CBSE Sample Papers for Class 12 Economics Term 2 Set 3 with Solutions

Some Infrastructure in India and Other Countries, 2018
CBSE Sample Papers for Class 12 Economics Term 2 Set 3 With Solutions 2
Sources: World Development Indicators 2019, World Bank website: www.worldbank.org.:
BP Statistical Review of World Energy 2019, 69th Edition

Note : (*) refers to Grass Capital Formation.

Read the following text carefully and answer questions number 8 and 9 given below:

India vs Pakistan: A tale of two economies
NEW DELHI : India and Pakistan – two of the biggest South Asian nations – started their economic journey around the same time after gaining Independence. Not many know that there was a point in the 1960s when Pakistan’s per capita GDP used to be higher than that of India’s. However, over the years, India has not only surpassed Pakistan’s per capita GDP but taken a commanding lead on almost every economic front.

Pakistan today is facing global criticism for failing to rein in homegrown terror groups even as it grapples with an ailing economy and mounting global debt. India, on the other hand, has become a global frontrunner which recently surpassed the UK to become the fifth-largest economy in the world. The stark economic contrast between the two neighbors shows that Pakistan’s unstable government, conflicting power centres, covert support to terror groups, and involvement in global terror strikes such as the 26/11 Mumbai attacks, have bled its economy.

From a higher per capita GDP of $83.33 in 1960, Pakistan’s today lags much behind India which witnessed a multi-fold raise its per capita GDP over the years. From 2007, India’s per capita GDP has consistently stayed higher than that of Pakistan’s. India is today the fastest-growing trillion-dollar economy in the world and the fifth-largest overall, according to data compiled by IMF’s World Economic Outlook.

It jumped from the 9th spot in 2010 to the 5th spot in a span of just 9 years. The GDP of India is almost 10 times that of Pakistan, which is placed at the 45th position.

CBSE Sample Papers for Class 12 Economics Term 2 Set 3 with Solutions

India’s rise has been even more dramatic across the past couple of years. Since 2008, India’s GDP has risen almost 140 per cent as against an increase of about 63 percent for Pakistan.

https://timesofindia.indiatimes.com/ business/india-business/india-vs- pakistan-a-tale-of-two-economies/ articleshow/7945005 l.cms
Answer:
Though it is widely understood that infrastructure is the foundation of development, India is yet to wake up to the call. India invests only 30 percent of its GDP on infrastructure, which is far below that of China. So it can be concluded that India is investing in infrastructural facilities less than China and this gap is too large. Some economists have projected that India will become the third biggest economy in the world a few decades from now. Considering this fact, this is a relatively lower proportion in this direction. For that to happen, India will have to boost its infrastructure investment.

Question 8.
“India and Pakistan started their economic journey at the same time but now India is far ahead of Pakistan.” In the light of above statement, give any two reasons. (3)
Answer:
India is ahead of Pakistan as following have affected Pakistan’s economy:

(i) Unstable Government: In 1950, Pakistan’s per person GDP was US $1268, which was almost 50 per cent greater than India that year. However, in the backdrop of sustained political uncertainty and upheaval, Pakistan stagnated throughout the 1950s while a politically stable India grew. As a result, by 1960, India had almost caught up with Pakistan in per capita GDP terms with the per capita income gap having shrunk to 15 percent.

(ii) Homegrown Terror Groups or Ailing Economy: Pakistan’s economy has suffered a direct and indirect cost linked to terrorist activities of almost $126.79 billion, which is equal to ₹10762.14 billion. Pakistan today is facing global criticism for failing to rein in homegrown terror groups even as it grapples with an ailing economy and mounting global debt.

Question 9.
Compare and analyze India and Pakistan economies in the terms of GDP growth. (3)
Answer:
India has surpassed Pakistan’s per capita GDP over the years. From 2007, India’s per capita GDP has consistently stayed higher than that of Pakistan’s. India is today the fastest-growing trillion-dollar economy in the world and the fifth Largest overall, according to data compiled by IMF’s World Economic Outlook. It jumped from the 9th spot in 2010 to the 5th spot in a span of just 9 years. The GDP of India is almost 10 times that of Pakistan, which is pLaced at the 45th position. Since 2008, India’s GDP has risen almost 140 percent as against an increase of about 63 percent for Pakistan.

CBSE Sample Papers for Class 12 Economics Term 2 Set 3 with Solutions

Question 10.
Suppose a ban is imposed on the consumption of tobacco. Examine its likely effects on:
(A) gross domestic product, and (B) welfare. (3)
Answer:
(A) Ban on the consumption of tobacco will bring down the production of tobacco. Since it is counted in GDP, GDP will fall.
(B) The ban will improve health in general. It will thus increase welfare.

Question 11.
“To boost the falling demand in the economy, Reserve Bank of India recently reduced Repo Rate and Reverse Repo Rate.” Elaborate the rationale behind the steps taken by the Central Bank. (5)
Answer:
The steps taken by the Central Bank to boost the falling demand in the economy are justified as the reduction in the Repo rate and Reverse Repo Rate will increase the availability of funds in the market through the commercial banks. Rationale: A decrease in Repo/Reverse Repo Rate will push the commercial banks to reduce the lending rate and will eventually make the borrowings cheaper for the general public. As a result, the consumption demand in the economy may increase.

Question 12.
(A) Define ‘net factor income from abroad’. How is it different from ‘net exports’?
(B) Calculate the value of “Rent” from the following data:

Particulars Amount (In ₹ crores)
Gross Domestic Capital Formation 18,000
Mixed-Income of Self Employed 7,000
Subsidies 250
Interest 800
Rent ?
Profit 975
Compensation of Employees 6,000
Consumption of Fixed Capital 1,000
Indirect Tax 2,000

CBSE Sample Papers for Class 12 Economics Term 2 Set 3 with Solutions

OR

(A) State any two precautions that must be taken into consideration while estimating national income by the value-added method. (5)

(B) In an economy, the following transactions took place. Calculate the value of output and value-added by Firm B: i. Firm A sold to firm B goods of 80 crores; to firm C 50 crore; to househoLd 30 crore and goods of vaLue, 10 crore remains unsold ii. Firm B sold to firm C goods of 70 crores; to firm D 40 crore; goods of vaLue 30 crores were exported and goods of value 5 crores were sold to the government. (5)
Answer:
(A) Net Factor Income from Abroad is the excess of factor incomes (rent, wages, interest, profit) earned from abroad over factor incomes (rent, wages, interest, profit) paid to abroad, whereas; net export refers to the excess of the value of exports over the value of imports of a country in an accounting year.

(B) GDPMP = NDPFC + Depreciation + Net indirect tax
(i) = (vii) + (ii)+ [(iv) + (vi) + Rent] + (viii) + [(ix)-(iii)]
18000 = (6000 + 7000 + (800 + 975 + Rent) + 1000 + (2000 – 250) 18000
= 17525 + Rent Rent
= ₹ 475 crore
OR
(A) Precautions of value added method are:

  1. Value of sale and purchase of second hand goods is not considered while estimating value added as the value of second hand goods is already accounted during the year they were produced.
  2. Value of intermediate goods is not included in the estimation of value added because value of intermediate goods is reflected in the value of final goods.

(B) Value of output of firm B = Sales of firm B to firm C + Sales of firm B to firm D + Exports + Sales of firm B to Government = 70 + 40 + 30 + 5 = 145 crores Value Added by Firm B = Value of output by Firm B – Purchases by Firm B from firm A = 145 – 80 = 65 crores

Question 13.
(A) “If the rate of resource extraction exceeds the rate of regeneration, it leads to a reduction in carrying capacity of the environment.” Discuss the rationale of the given statement with valid reasons.

(B) Over 60% of India’s arable and is estimated to suffer from environmental degradation. This has been caused by both by a rapidly growing poor population seeking subsistence and by the misappropriation of natural resources by the wealthy for Luxury consumption. In the Light of these Unes, state and discuss any two principaL causes of environmental degradation. (5)
Answer:
(A) The environment is able to perform its functions uninterruptedly so long as the demand for these functions is within the carrying capacity of the environment. This means that the resources are not extracted beyond the rate of their regeneration. If there is a disequilibrium (demand being more than supply), the environment fails to replenish itself and it will lead to environmental crisis. Thus, to maintain a healthy environment, the carrying capacity of the environment must be valued and respected.

CBSE Sample Papers for Class 12 Economics Term 2 Set 3 with Solutions

(B) Two principal causes behind environmental degradation:

  1. Population Rise: Rising population is one of the major causes for degradation of the environment as it adds to the burden on natural resources, leading to environmental crisis.
  2. Consumption Levels: It has been observed that the developing and developed nations have witnessed affluent consumption levels in the past, bringing disequilibrium in the demand and supply of the natural resources, pushing the world to the threshold of the environmental crisis.

CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions

Students can access the CBSE Sample Papers for Class 12 Chemistry with Solutions and marking scheme Term 2 Set 6 will help students in understanding the difficulty level of the exam.

CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions

Time Allowed: 2 Hours
Maximum Marks: 35

General Instructions:

  • There are 12 questions in this question paper with internal choice.
  • SECTION A – Q. No. 1 to 3 are very short answer questions carrying 2 marks each.
  • SECTION B – Q. No. 4 to 11 are short answer questions carrying 3 marks each.
  • SECTION C- Q. No. 12 is case based question carrying 5 marks.
  • All questions are compulsory.
  • Use of log tables and calculators is not allowed.

Section – A
(Section A-Question No 1 to 3 are very short answer questions carrying 2 marks each.)

Question 1.
Name the reagents used in the following reactions: (Any two) (2)
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 1
Answer:
(A)
LiAlH4

Explanation:
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 2

(B) KMnO4/KOH, heat

Explanation:
When ethyl benzene is oxidised with alkaline KMnO4 or acidic Na2Cr2O7, the entire side chain (in benzene homologues) with at least one H at a carbon, regardless of length is oxidised to -COOH
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 3

(C) H2/Pd – BaSO4

Explanation:
Rosenmund reduction is a hydrogenation process in which an acyl chloride is selectively reduced to an aldehyde. The reaction was named after Karl Wilhelm Rosenmund who first reported it.

So, benzoyl chloride is reduced to benzaldehyde in presence of Pd-BaSO4 and H2.
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 4

Question 2.
Give reason
(A) Boiling point of methyl amine is 60°C while that of trimethyl amine is 30°c. State reason for this difference in boiling point.
Answer:
Trimethyl amine is a tertiary amines and it does not have hydrogen atoms bonded to the nitrogen atom and therefore are not hydrogen bond donors. Thus tertiary amines cannot form intermolecular hydrogen bonds. As a result., they have lower boiling points than primary amine like methyl amine.

(B) Why does Aniline not react with dilNaOH? (2)
Answer:
Aniline does not react with dil. NaOH because in basic conditions, the molecule is uncharged and only very slightly polar. Its polarity is so low that interactions between water and the NH2– group are not sufficient to make the molecule, souble in water.

CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions

Question 3.
Identify which of the following AX, AY or AZ indicates a strong .weak or a non electrolyte. (2)
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 5
Answer:
AX – fig (a) indicates a non electrolyte as the particles do not dissociate at all.
Examples:

AY -fig (b) indicates a Weak Electrolytes: as the particles are not completely dissociated into ions in solution.
Examples: CH3COOH, NH4OH, HCN etc.

AZ -fig (c) indicates a Strong Electrolytes: In these electrolytes particles completely dissociateinto ions in solution.
Examples: HCl, KCl, NaOH, NaCl

Section – B
(Section B-Question No 4 to 11 are short answer questions carrying 3 marks each.)

Question 4.
(A) Identify the Coordination complex which contain Cyanide as the ligand and Iron as the central metal atom. This complex is used to identify both Cu2+ and Fe3+ cation during salt analysis.
Answer:
The coordination complex is K4[Fe(CN)6]

Related Theory:
Both Cu2+ and Fe3+ are detected with potassium fer- rocyanide in the following manner
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 6

(B) While NH2 is a strong ligand but NH4+ is not. Explain.
Answer:
Ammonia is converted into ammonium ion in the following manner:
NH3 + H+ ⇌ NH4+

Complexes are formed by donation of a pair of electrons from ligand to metal. In ammonia, N atom has one lone pair of electrons. So it can form complexes. Nitrogen donates this lone pair of electrons to proton to form ammonium ion. NH4+ ion does not possess any lone pair of electrons which it can donate to central metal ion hence it does not form complexes.

(C) Select bidentate of didentate ligand from the following? (3)
CO, SCN–, CH3COO–, C2O42-
Answer:
Bidentate Ligand are the one which donates 2 pair of electrons to metal atom. Among the options provided, C2C>42_ is the only Ligand which is bidentate ligand. It donates electrons from its 2 oxygen atoms.

Question 5.
Answer the following question:
(A) Bleeding due to a small cut is stopped by applying alum.
Answer:
Alum is used to stop blood from a cut. It allows the blood clot to form. The high ionic strength promotes flocculation of the blood . Thus, blood is positive sol and sol particles are coagulated more efficiently by S042~ ions

(B) You must have observed at sunset an orange colour develops in the sky .Why is it so?
Answer:
At the time of sunset, the sun is at horizontal. The Light emitted by the sun has to travel a relatively longer distance through the atmosphere. As a result, blue part of light is scattered away by the particulate (colloidal particles)in the atmosphere causing red part to be visible.

(C) Why is Chemisorption called activated absorption? (3)
Answer:
Chemisorption is also called as activated adsorption because there is an involvement of chemical bond formation between the reactants and the adsorbent. This formation of chemical bonds requires a high activation energy.

Related Theory:
Chemisorption is highly specific in nature as the molecules are held on the solid surface through a chemical bond. For eg., oxygen is adsorbed on metals due to oxide formation and also hydrogen gets adsorbed on metals due to hydride formation

CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions

Question 6.
(A) Name the cell that drives a non-spontaneous redox reaction through the application of electrical energy with the help of a suitable example
Answer:
An electrolytic cell is an electrochemical cell that drives a nonspontaneous redox reaction through the application of electrical energy.

Example: The decomposition of water into hydrogen and oxygen, and bauxite into aluminum and other chemicals.

(B) How much electricity in Faraday is required to produce
(i) 80g of Ca from molten CaCl2?
Answer:
From given data,
Ca2+ + 2e– → Ca

Electricity required to produce 40 g of calcium = 2 F
Therefore, electricity required to produce
80 g of calcium = \(\frac{2 \times 80}{40}\)F
= 4 F

(ii) 54g of Al from molten Al2O3?
OR
A voltaic cell is set up at 25°C with the following half cells:
\(\frac{\mathrm{Al}}{\mathrm{Al}^{3+}}\) (0.001M) and \(\frac{\mathrm{Ni}}{\mathrm{Ni}^{2+}}\) (0.50M).
Write an equation for the reaction that occurs when the cell generates an electric current and determine the cell potential. (3)
Answer:
From given data
Al3+ + 3e– → Al

Electricity required to produce 27 g of Al
= 3 F

Therefore, electricity required to produce 54g of Al = \(\frac{3 \times 54}{27}\)F
= 6 F
OR
E0(Al3+/Al) = – 1.66V, E0(Ni2+/Ni) = -0.25V

Anode: [Al → Al3+ + 3e–] × 2
Cathode: [Ni2+ + 2e– → Ni] × 3

Net cell reaction: 2Al +3Ni2+ → 2Al3++ 3Ni
n = 6
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 7

Caution:
Students should not forget to put powers of stoichiometric coefficients on the concentrations of products and reactants in Nernst equation.

Question 7.
Account for the following:
(A) Which metal in the first transition series (3d series) exhibits +1 oxidation state most frequency and why?
Answer:
Copper exhibits + 1 oxidation state more frequently i.e., Cu+1 because of its electronic configuration 3d104s1. It can easily lose 4s1 electron to give stable 3d10 configuration.

(B) Which of the following cations are coloured in aqueous solutions and why? SC3+, V3+, Ti4+, Mn2+.
(At. nos. Sc = 21, V = 23, Ti = 22, Mn = 25)
Answer:
Sc3+ = 4S° 3d3 = no unpaired electron
V3+ = 3d2 4s° = 2 unpaired electron
Ti4+ = 3d° 4s° = no unpaired electron
Mn2+ = 3d5 4s° = 5 unpaired electron
Thus V3+ and Mn2+ are coloured in their aqueous solution due to presence of unpaired electron.

(C) The transition metals (with the exception of Zn, Cd and Hg) are hard and have high melting and boiling points. In Zn, Cd and Hg, all the electrons in d-subshell are paired. Hence, the metallic bonds present in them are weak (3)
Answer:
The transition metals (with the exception of Zn, Cd and Hg) are hard and have high melting and boiling points because of stronger metallic bonding and high enthalpies of atomization.

Question 8.
Answer the following questions:
(A) Give the product for:
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 8
Answer:
NaBH4 does not reduce ester group. It is mild reducing reagent which reduces aldehyde and ketone into their respective alcohols.
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 9

(B) Which among the following will undergo cannizaro reaction? Benzaldehyde, acetone .formaldehyde
Answer:
Benzaldehyde and formaldehyde undergo cannizaro reaction as these compounds do not contain alpha hydrogen

Related Theory:
An alpha carbon is the first carbon that is joined to the functional group. In the case of aldehydes and ketones, a functional group is a carbonyl group. The functional group is responsible for the formation of alpha hydrogen.
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 10

(C) Iodoform reaction is obtained when methyl ketones react with hypoiodite not with iodine. Why? (3)
Answer:
Hypoiodite ion is very strong oxidising agent .hence it can oxidise methyl ketone to iodoform, iodide ion is a reducing agent and hence it cannot oxidise methyl ketone to iodoform.

Related Theory:
Reaction of Iodine with NaOH gives sodium hypoiodite
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 11
The Haloform Reaction;
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 12
Formation of carboxylic acids only happens with methyl ketones
Iodoform test (NaOH/I2) is historically valuable for identifying methyl ketones

Question 9.
Write the IUPAC names of the foLlowing coordination compounds
(A) [Cr(NH3)3Cl3]
(B) K4[Fe(CN)6]
(C) [CoBr2(en)2]+, (en = ethylenediamine)
OR
(A) Write the formulae for the following coordination compounds:
(i) Tetraammineaquachloridocobalt (III) chloride
(ii) Potassium tetracyanonickelate (II)
(B) Write the hybridization of the complex
[NiCl4]2-. (Atomic number of Ni = 28) (3)
Answer:
(A) Triamminetrichloridochromium (III)

(B) Potassiumhexacyanidooferrate (III)

(C) Dibromidobis (ethane 1, 2-diamine) cobalt (III)
OR
(A) (i) [Co(NH3)4(H2O)Cl]Cl2
(ii) K2[Ni(CN)4]

(B) Ni(28) : [Ar] 4s23d8
Ni2+: [Ar] 4s°3d8
Since Cl– is a weak field ligand, the pairing of electrons will not take place.
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 13
It has sp3 hybridization. It has a tetrahedral shape and complex is paramagnetic in nature due to presence of unpaired electrons.

Question 10.
Write the structures of the main product when acetone (CH3—CO—CH3) reacts with the following reagents.
(A) Zn—Hg/Conc. HCl
(B) H2N—NHCONH2/H+
(C) CH3MgBr and then H3O+
OR
An organic compound (A) (molecular formula C8H16O2) was hydrolysed with dilute sulphuric acid to give a carboxylic acid (B) and an alcohol (C). Oxidation of (C) with chromic acid also produced (B). On dehydration (C) gives but-l-ene. Write the equations for the reactions involved. (3)
Answer:
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 14
Related Theory:
Clemmensen reduction is used to reduce aldehydes and ketones to hydrocarbons. Zinc amalgam and concentrated hydrochloric acid are used as Clemmensen’s reagent Clemmensen reduction is a reaction which involves the reduction of a carbonyl compound to form a simple hydrocarbon.

CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 15
Related Theory:
Semicarbazones are derivatives of aldehydes and ketones produced by the condensation reaction between a ketone or aldehyde and semicarbazide. Semicarbazones are useful for identification and characterization of aldehydes and ketones.

CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 16
Explanation:
Organic compound A is an ester as on acid hydrolysis it gives a mixture of an acid and an alcohol.
Oxidation of alcohol (C) gives acid (B). Hence, the number of carbon atoms in (B) and (C) are same.
Ester (compound A) has eight C atoms. Hence, both carboxylic acid B and alcohol C must contain 4 C atoms each.
Dehydration of alcohol C gives but-l-ene. Hence, C must be a straight chain alcohol, i.e butan-l-ol Oxidation of (C) gives (B). Hence, (B) is butanoic acid.

Question 11.
Write the chemical equations involved when aniline is treated with the following reagents:
(i) Br2 water
(ii) CHCl3 + KOH
(iii) HCl
OR
Explain giving suitable reason:
(i) Aniline does not undergo Friedel-Crafts reaction.
(ii) p-methylaniline is more basic than p nitroaniline.
Answer:
CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions 17
OR
(i) Since aniline is basic, it reacts with Lewis acid AlCl3 to form salt. .
(ii) It is because methyl group in p methylaniline is electron releasing, it donates electrons for donation whereas nitrogroup in p– nitroaniline is electron withdrawing.
(iii) Since -NH2 group is ortho -para directing hence acetylation is done so as to decrease the reactivity of Aniline towards electrophilic substitution reactions.

CBSE Sample Papers for Class 12 Chemistry Term 2 Set 6 with Solutions

Section – C
(Section C-Question No 12 is case-based question carrying 5 marks.)

Question 12.
Read the passage given below and answer the questions that follow:
Reaction 1 Initiation
CH3CHO → CH3 + CHO
Propagation
CH3 + CH3CHO → CH3CO + CH4
CH3CO → CH3 + CO

Termination
2 .CH3 → C2H6

Reaction 2
decomposition of acetaldehyde is an example of fractional order reaction because the order of the reaction is a fractional value.
It can be a whole number or a fraction. It can be noted that when the order of reaction is a fraction, the reaction is generally a chain reaction or follows some other complex mechanism. An example of a chemical reaction with a fractional reaction order is the pyrolysis of acetaldehyde.

The rate of decomposition of acetaldehyde into methane and CO in the presence of 12 at 800 K follows the rate law:
Rate = k[CH3CHO][I2l
The decomposition is believed to go by a two- step mechanism:
CH3CHO + I2 → CH3I + CO + HI
CH3I + HI → CH4 + I2
(A) Which of the two steps is a slower one?
(B) Explain why order cannot be determined by a balanced chemical equation
(C) Give one example of fractional order reaction.
(D) A reaction is of first order in reactant A and of second order in reactant B. How is the rate of this reaction affected when:
(i) the concentration of B alone is increased to three times.
(ii) the concentrations of A as well as B are doubled?
OR
A reaction is of second order with respect to a reactant. How is the rate of reaction affected if the concentration of the reactant is reduced to half? What is the unit of rate constant for such a reaction? (5)
Answer:
(A) Rate law is obtained from the slowest step Hence step 1: CH3CHO + I2 → CH3I + CO + HI this step is the slower one Here I2 is the catalyst as it is consumed in first step and regenerated in the next step.

(B) The sum of powers of the concentration of the reactants in the rate law expression is .called the order of that chemical reaction. Order cannot be determined by a balanced chemical equation it may or may not be equal to the sum of stoichiometric coefficients as it is an experimental property.

(C) Decomposition of acetaldehyde Explanation- The order of the decomposition of acetaldehyde is 3/2 or 1.5.

(D) r = k[A]1 [B]2
(i) When concentration of B increases to 3 times, the rate of reaction becomes 9 times
r = kA(3B)2 ∴ r = 9kAB2 = 9 times

(ii) r = k(2A) (2B)2 ∴ r = 8kAB2 = 8 times
OR
Rate = k [A]2 = ka2
If [A] = \(\frac{1}{2 a}\); Rate = k \(\left(\frac{a}{2}\right)^{2}=\frac{1}{4}\)ka2

∴ Rate = 1/4th (one fourth of original rate)
The unit of rate constant is L mol-1 s-1